MirGeneDB

Gene name

Tca-Mir-9-o6-v1

Family name MIR-9 (all species)
MiRBase ID tca-mir-9d
Paralogues Tca-Mir-9-o3  Tca-Mir-9-o4  Tca-Mir-9-o5  Tca-Mir-9-o6-v2  Tca-Mir-9-o7-v1  Tca-Mir-9-o7-v2 
Orthologues Bfl-Mir-9-P6  Cte-Mir-9  Isc-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (gene) T. castaneum
Node of Origin (family) Bilateria
Genome context
(Tcas5.2)
LG5: 7455728-7455787 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-9-o6-v1)
Mir-9-o6-v2 LG5: 7455728-7455788 [+] Ensembl
Mir-2-o56b LG5: 7455840-7455901 [+] Ensembl
Mir-309-P4 LG5: 7455958-7456014 [+] Ensembl
Mir-3893 LG5: 7457235-7457292 [+] Ensembl
Mir-309-P6 LG5: 7457335-7457391 [+] Ensembl
Mir-309-P5 LG5: 7457453-7457508 [+] Ensembl
Mir-36 LG5: 7457551-7457607 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GCACCCGUAGAAAUACGUCUACUUUAUAUUUCUUUGGUGAUCUAACUUAUGAUUAACUUUAUAAGUCAUAAAGCUAGAUUCACCAAAGAAAUAUGUGGUUGGCAACGCUACGUUCUGAAG
Get precursor sequence
Structure
        10         20        30         40         50         
GCACCCGUAGAAAUACG-  U   U               -     A -|     UUAACU 
                  UC ACU UAUAUUUCUUUGGUG AUCUA C UUAUGA      \
                  GG UGG GUAUAAAGAAACCAC UAGAU G AAUACU      U
GAAGUCUUGCAUCGCAAC  U   U               U     C A^     GAAUAU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Star sequence

Tca-Mir-9-o6-v1_5p*

MirBase accessionMIMAT0018748
Sequence
0- UCUUUGGUGAUCUAACUUAUGA -22
Get sequence
Mature sequence

Tca-Mir-9-o6-v1_3p

MirBase accessionMIMAT0018749
Sequence
37- AUAAAGCUAGAUUCACCAAAGAA -60
Get sequence
Seed sequenceUAAAGCU