MirGeneDB

Gene name

Tca-Mir-9-o5

Family name MIR-9 (all species)
MiRBase ID tca-mir-9c
Paralogues Tca-Mir-9-o3  Tca-Mir-9-o4  Tca-Mir-9-o6-v1  Tca-Mir-9-o6-v2  Tca-Mir-9-o7-v1  Tca-Mir-9-o7-v2 
Orthologues Bfl-Mir-9-P5  Cte-Mir-9  Isc-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (gene) D. rerio
Node of Origin (family) Bilateria
Genome context
(Tcas5.2)
LG3: 15689817-15689876 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-9-o5)
Mir-3841 LG3: 15689576-15689634 [+] Ensembl
Mir-3840 LG3: 15689698-15689754 [+] Ensembl
Mir-2-o56a LG3: 15689938-15689994 [+] Ensembl
Mir-279-o23 LG3: 15690069-15690126 [+] Ensembl
Mir-3843 LG3: 15690171-15690228 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UACUUGUGAUUUUGCUAACGCGUUAUCACUUCUUUGGUGAUCUAGCCGUGUGAAUUAUUUUUGAAAUCACGCGUCUAAGUCGCCAAGAUUUGAUGAUGUGUCUAACAACUGGAGAUUUAA
Get precursor sequence
Structure
        10          20        30        40        50          
UACUUGUGAUUUUGCUA--|          CU    U     UC   C       AUUAUU 
                   ACGCGUUAUCA  UCUU GGUGA  UAG CGUGUGA      \
                   UGUGUAGUAGU  AGAA CCGCU  AUC GCGCACU      U
AAUUUAGAGGUCAACAAUC^          UU    -     GA   U       AAAGUU 
.       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Mature sequence

Tca-Mir-9-o5_5p

MirBase accessionMIMAT0018714
Sequence
0- UCUUUGGUGAUCUAGCCGUGUGA -23
Get sequence
Seed sequenceCUUUGGU
Star sequence

Tca-Mir-9-o5_3p*

MirBase accessionMIMAT0018715
Sequence
38- ACGCGUCUAAGUCGCCAAGAUU -60
Get sequence