MirGeneDB

Gene name

Tca-Mir-67-v1

Family name MIR-67 (all species)
MiRBase ID tca-mir-307
Paralogues Tca-Mir-67-v2  Tca-Mir-67-v3 
Orthologues Asu-Mir-67  Cel-Mir-67  Cte-Mir-67  Dme-Mir-67  Dpu-Mir-67  Isc-Mir-67  Lgi-Mir-67 
Node of Origin (gene) T. castaneum
Node of Origin (family) Protostomia
Genome context
(Tcas5.2)
LG8: 13556470-13556530 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-67-v1)
Mir-67-v2 LG8: 13556470-13556530 [+] Ensembl
Mir-67-v3 LG8: 13556470-13556530 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GGUGAAAUGAAGCCACUAUCUAUCUCGGUGACUCACUCAACCUGGGUGUGAUGUGUUUGCUGUACCAUCACAACCUCCUUGAGUGAGCGACCGGGUGGAUAUCACCGACAUUUUUACACCA
Get precursor sequence
Structure
        10            20        30        40        50         
GGUGAAAUGAAGCCACU----|      U    GA         CCU  G       UGUUU 
                     AUCUAUC CGGU  CUCACUCAA   GG UGUGAUG     G
                     UAGGUGG GCCA  GAGUGAGUU   CC ACACUAC     C
ACCACAUUUUUACAGCCACUA^      -    GC         CCU  A       CAUGU 
 .       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Star sequence

Tca-Mir-67-v1_5p*

MirBase accessionMIMAT0019129
Sequence
0- ACUCACUCAACCUGGGUGUGAUG -23
Get sequence
Mature sequence

Tca-Mir-67-v1_3p

MirBase accessionMIMAT0008389
Sequence
37- UCACAACCUCCUUGAGUGAGCGAC -61
Get sequence
Seed sequenceCACAACC