MirGeneDB

Gene name

Tca-Mir-3809

Family name MIR-3809 (all species)
MiRBase ID tca-mir-3809
Paralogues
Orthologues
Node of Origin (gene) T. castaneum
Node of Origin (family) T. castaneum
Genome context
(Tcas5.2)
LGX: 6585862-6585919 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-3809)
Mir-3825 LGX: 6586009-6586065 [+] Ensembl
Mir-3821-v2 LGX: 6586315-6586372 [+] Ensembl
Mir-3821-v1 LGX: 6586315-6586372 [+] Ensembl
Mir-11635 LGX: 6586742-6586801 [+] Ensembl
Mir-3820 LGX: 6587625-6587682 [+] Ensembl
Mir-3814 LGX: 6587955-6588013 [+] Ensembl
Mir-11636 LGX: 6593233-6593288 [+] Ensembl
Mir-3822 LGX: 6594368-6594426 [+] Ensembl
Mir-3816-v2 LGX: 6594971-6595029 [+] Ensembl
Mir-3816-v1 LGX: 6594971-6595029 [+] Ensembl
Mir-3811-P6 LGX: 6595867-6595926 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
ACAAAACUAAUUCAUUAAUGUUUGGCGGAAAUCAUAACUUGCUCGCUGAUGUAAUUUUAACAGACGUCGGUCAGUUGGUUAUGAAUUCUGAUAAAUGUUUGCUCUUCUAAAUGGUUAA
Get precursor sequence
Structure
        10           20        30        40        50        
ACAAAACUAAUUCAUUA---|      G     A        U   C        AAUUU 
                    AUGUUUG CGGAA UCAUAACU GCU GCUGAUGU     \
                    UGUAAAU GUCUU AGUAUUGG UGA UGGCUGCA     U
AAUUGGUAAAUCUUCUCGUU^      A     A        U   C        GACAA 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Mature sequence

Tca-Mir-3809_5p

MirBase accessionMIMAT0018640
Sequence
0- AUCAUAACUUGCUCGCUGAUGU -22
Get sequence
Seed sequenceUCAUAAC
Star sequence

Tca-Mir-3809_3p*

MirBase accessionMIMAT0018641
Sequence
35- GUCGGUCAGUUGGUUAUGAAUUC -58
Get sequence