MirGeneDB

Gene name

Tca-Mir-3049

Family name MIR-3049 (all species)
MiRBase ID tca-mir-3049
Paralogues
Orthologues
Node of Origin (gene) Pterygota
Node of Origin (family) Pterygota
Genome context
(Tcas5.2)
LG6: 4828785-4828843 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GGCGCAGGGACAUGGGGGCGCCACAUGGGGUCGGGAAGACAGUUGCGGCGGAUUUCGUUUUUUCAAGUCCGUUCGCUGCAUUCCCAGCCUCGGGAAGACAGUUGCGGCGGAUUUCGUUUUUUCAAGUCCGUUCGCUGCAUUCCCAGCCCGGUGUCGUGCCGAGGCAGCAAGGGGGCGC
Get precursor sequence
Structure
        10          20        30        40        50         
GGCGCAGGGACAUGGGG--|   C    G GGUCGGGAAGACAGUUGCGGCGGAUUUCGU 
                   GCGC ACAU G                              \
                   CGUG UGUG C                              U
CGCGGGGGAACGACGGAGC^   C    G CCGACCCUUACGUCGCUUGCCUGAACUUUU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Star sequence

Tca-Mir-3049_5p*

MirBase accessionMIMAT0018777
Sequence
37- UCCGUUCGCUGCAUUCCCAGCC -59
Get sequence
Mature sequence

Tca-Mir-3049_3p

MirBase accessionMIMAT0018776
Sequence
0- UCGGGAAGACAGUUGCGGCGGAUU -24
Get sequence
Seed sequenceCGGGAAG