MirGeneDB

Gene name

Tca-Mir-3049

Family name MIR-3049 (all species)
MiRBase ID tca-mir-3049
Paralogues
Orthologues
Node of Origin (gene) Pterygota
Node of Origin (family) Pterygota
Genome context
(Tcas5.2)
LG6: 4828785-4828843 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GGCGCAGGGACAUGGGGGCGCCACAUGGGGUCGGGAAGACAGUUGCGGCGGAUUUCGUUUUUUCAAGUCCGUUCGCUGCAUUCCCAGCCCGGUGUCGUGCCGAGGCAGCAAGGGGGCGC
Get precursor sequence
Structure
        10          20        30        40        50          
GGCGCAGGGACAUGGGG--|   C    G    C     GA    UGC        UCGUU 
                   GCGC ACAU GGGU GGGAA  CAGU   GGCGGAUU     \
                   CGUG UGUG CCCG CCCUU  GUCG   UUGCCUGA     U
CGCGGGGGAACGACGGAGC^   C    G    A     AC    C--        ACUUU 
       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Mature sequence

Tca-Mir-3049_5p

MirBase accessionMIMAT0018776
Sequence
0- UCGGGAAGACAGUUGCGGCGGAUU -24
Get sequence
Seed sequenceCGGGAAG
Star sequence

Tca-Mir-3049_3p*

MirBase accessionMIMAT0018777
Sequence
37- UCCGUUCGCUGCAUUCCCAGCC -59
Get sequence