MirGeneDB

Gene name

Tca-Mir-29-P2

Family name MIR-29 (all species)
MiRBase ID tca-mir-29
Paralogues Tca-Mir-29-P1c  Tca-Mir-29-P1d 
Orthologues Aca-Mir-29-P2a  Aca-Mir-29-P2b-v1  Aca-Mir-29-P2b-v2  Ami-Mir-29-P2a-v1  Ami-Mir-29-P2a-v2  Ami-Mir-29-P2b-v1  Ami-Mir-29-P2b-v2  Asu-Mir-29-P2  Bfl-Mir-29-P2  Bta-Mir-29-P2a  Bta-Mir-29-P2b5  Bta-Mir-29-P2b6  Cel-Mir-29-P2  Cfa-Mir-29-P2a  Cfa-Mir-29-P2b-v1  Cfa-Mir-29-P2b-v2  Cgi-Mir-29-P2  Cli-Mir-29-P2a  Cli-Mir-29-P2b-v1  Cli-Mir-29-P2b-v2  Cpi-Mir-29-P2a  Cpi-Mir-29-P2b-v1  Cpi-Mir-29-P2b-v2  Cpo-Mir-29-P2a  Cpo-Mir-29-P2b  Cte-Mir-29-P2  Dme-Mir-29-P2  Dno-Mir-29-P2a  Dno-Mir-29-P2b-v1  Dno-Mir-29-P2b-v2  Dre-Mir-29-P2a  Dre-Mir-29-P2b1  Dre-Mir-29-P2b2  Efe-Mir-29-P2c  Efe-Mir-29-P2d  Ete-Mir-29-P2a  Ete-Mir-29-P2b-v1  Ete-Mir-29-P2b-v2  Gga-Mir-29-P2a  Gga-Mir-29-P2b-v1  Gga-Mir-29-P2b-v2  Hsa-Mir-29-P2a  Hsa-Mir-29-P2b-v1  Hsa-Mir-29-P2b-v2  Mml-Mir-29-P2a  Mml-Mir-29-P2b-v1  Mml-Mir-29-P2b-v2  Mmu-Mir-29-P2a  Mmu-Mir-29-P2b  Ocu-Mir-29-P2a  Ocu-Mir-29-P2b  Pfl-Mir-29-P2  Pmi-Mir-29-P2  Rno-Mir-29-P2a  Rno-Mir-29-P2b3  Rno-Mir-29-P2b4  Sha-Mir-29-P2a  Sha-Mir-29-P2b-v1  Sha-Mir-29-P2b-v2  Sko-Mir-29-P2  Spu-Mir-29-P2  Xtr-Mir-29-P2a  Xtr-Mir-29-P2b 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(Tcas5.2)
LG9: 3035860-3035918 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GAACAAUAGUUGUAGGAUUUGGCUUUGGGCACUGUUUUCGUGUGGUGGUGAGAUUUUAUUUUGAUUCUAGCACCAUAUGAAAUCAGUUCUUGUACCAAAUACCAGCGAAAUACACCAAG
Get precursor sequence
Structure
        10           20        30        40        50         
GAACAAUAGUUGUAGGA---|    CUU    C    U            G G  AUUUUA 
                    UUUGG   UGGG ACUG UUUCGUGUGGUG U AG      U
                    AAACC   GUUC UGAC AAAGUAUACCAC A UC      U
GAACCACAUAAAGCGACCAU^    AU-    U    U            G -  UUAGUU 
       110       100         90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Star sequence

Tca-Mir-29-P2_5p*

MirBase accessionMIMAT0018802
Sequence
0- ACUGUUUUCGUGUGGUGGUGAG -22
Get sequence
Mature sequence

Tca-Mir-29-P2_3p

MirBase accessionMIMAT0018803
Sequence
37- UAGCACCAUAUGAAAUCAGUUC -59
Get sequence
Seed sequenceAGCACCA