MirGeneDB

Gene name

Tca-Mir-2-o52-v1

Family name MIR-2 (all species)
MiRBase ID tca-mir-2-2
Paralogues Tca-Mir-2-o51-v1  Tca-Mir-2-o51-v2  Tca-Mir-2-o52-v2  Tca-Mir-2-o53-v1  Tca-Mir-2-o53-v2  Tca-Mir-2-o54  Tca-Mir-2-o55  Tca-Mir-2-o56a  Tca-Mir-2-o56b  Tca-Mir-2-o56c 
Orthologues Asu-Mir-2-o52 
Node of Origin (gene) T. castaneum
Node of Origin (family) Protostomia
Genome context
(Tcas5.2)
LG3: 561350-561410 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-o52-v1)
Mir-3842 LG3: 559294-559352 [+] Ensembl
Mir-71 LG3: 560714-560776 [+] Ensembl
Mir-2-o53-v1 LG3: 560832-560890 [+] Ensembl
Mir-2-o53-v2 LG3: 560833-560889 [+] Ensembl
Mir-2-o54 LG3: 560954-561011 [+] Ensembl
Mir-2-o55 LG3: 561066-561124 [+] Ensembl
Mir-2-o51-v2 LG3: 561198-561260 [+] Ensembl
Mir-2-o51-v1 LG3: 561200-561258 [+] Ensembl
Mir-2-o52-v2 LG3: 561348-561412 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UUUGUACGAUUUUUCAUGGUGUAGGCUUUCGCUCAUCAUCUGGUUGUGAAAUGUGAAUUUAUAUCAUAUCACAGCCAGCUUUGAUGAGCGCAAGAGUGCACUGAUGACGUCAGGUACGAAA
Get precursor sequence
Structure
        10          20        30          40        50         
UUUGUACGAUUUUUCAU--      GG   U         U--|         A   UGAAU 
                   GGUGUA  CUU CGCUCAUCA   CUGGUUGUGA AUG     \
                   UCACGU  GAA GCGAGUAGU   GACCGACACU UAC     U
AAAGCAUGGACUGCAGUAG      GA   C         UUC^         A   UAUAU 
 .       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and thus these multiple paralogues in invertebrates other than Drosophila are classified here as orphans pending further data and analysis.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Star sequence

Tca-Mir-2-o52-v1_5p*

MirBase accessionMIMAT0019096
Sequence
0- GCUCAUCAUCUGGUUGUGAAAUG -23
Get sequence
Mature sequence

Tca-Mir-2-o52-v1_3p

MirBase accessionMIMAT0008353
Sequence
36- UAUCACAGCCAGCUUUGAUGAGCGC -61
Get sequence
Seed sequenceAUCACAG