MirGeneDB

Gene name

Tca-Mir-193-P2

Family name MIR-193 (all species)
MiRBase ID tca-mir-2788
Paralogues Tca-Mir-193-P1 
Orthologues Aca-Mir-193-P2a  Ami-Mir-193-P2a  Ami-Mir-193-P2b  Bta-Mir-193-P2a  Bta-Mir-193-P2b  Cel-Mir-193-P2-v1  Cel-Mir-193-P2-v2  Cfa-Mir-193-P2a  Cfa-Mir-193-P2b  Cgi-Mir-193-P2  Cli-Mir-193-P2a  Cli-Mir-193-P2b  Cpi-Mir-193-P2a  Cpi-Mir-193-P2b  Cpo-Mir-193-P2a  Cpo-Mir-193-P2b  Cte-Mir-193-P2  Dno-Mir-193-P2a  Dno-Mir-193-P2b  Dre-Mir-193-P2a1  Dre-Mir-193-P2a2  Dre-Mir-193-P2b1  Efe-Mir-193-P2c-v1  Efe-Mir-193-P2c-v2  Efe-Mir-193-P2d-v1  Efe-Mir-193-P2d-v2  Efe-Mir-193-P2e-v1  Efe-Mir-193-P2e-v2  Efe-Mir-193-P2f-v1  Efe-Mir-193-P2f-v2  Ete-Mir-193-P2a  Ete-Mir-193-P2b  Gga-Mir-193-P2a  Gga-Mir-193-P2b  Hsa-Mir-193-P2a-v1  Hsa-Mir-193-P2a-v2  Hsa-Mir-193-P2b  Lgi-Mir-193-P2  Mdo-Mir-193-P2b  Mml-Mir-193-P2a  Mml-Mir-193-P2b  Mmu-Mir-193-P2a  Mmu-Mir-193-P2b  Ocu-Mir-193-P2a  Ocu-Mir-193-P2b  Pfl-Mir-193-P2  Pmi-Mir-193-P2  Rno-Mir-193-P2a  Rno-Mir-193-P2b  Sha-Mir-193-P2a  Sha-Mir-193-P2b  Sko-Mir-193-P2  Xtr-Mir-193-P2b 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(Tcas5.2)
LG8: 5228629-5228689 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-193-P2)
Mir-193-P1 LG8: 5228763-5228819 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GCGGAUUGGAAGACAUUUGUUUAUGCAAUUUUGGGGUUUCUUAGCGGCAUUUGCCUCAAAUUACACUGCAAUGCCCUUGGAAAUCCCAAACAUGCAUGACGACUCAAAAUUUGAACGCGUU
Get precursor sequence
Structure
        10           20        30        40        50        60 
GCGGAUUGGAAGACAUU---|   U     AU            U  C      U  CUCAAA 
                    UGUU AUGCA  UUUGGGGUUUCU AG GGCAUU GC      \
                    GCAG UACGU  AAACCCUAAAGG UC CCGUAA CG      U
UUGCGCAAGUUUAAAACUCA^   -     AC            U  -      -  UCACAU 
 .       110       100         90        80         70
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site +1 relative to what is annotated here.
3' NTU No
MotifsNo
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Star sequence

Tca-Mir-193-P2_5p*

MirBase accessionMIMAT0018798
Sequence
0- UUGGGGUUUCUUAGCGGCAUUUGC -24
Get sequence
Mature sequence

Tca-Mir-193-P2_3p

MirBase accessionMIMAT0018799
Sequence
38- CAAUGCCCUUGGAAAUCCCAAAC -61
Get sequence
Seed sequenceAAUGCCC