MirGeneDB

Gene name

Tca-Mir-133

Family name MIR-133 (all species)
MiRBase ID tca-mir-133
Paralogues
Orthologues Aca-Mir-133-P1-v1  Aca-Mir-133-P1-v2  Aca-Mir-133-P2-v1  Aca-Mir-133-P2-v2  Aca-Mir-133-P3-v1  Aca-Mir-133-P3-v2  Aca-Mir-133-P4-v1  Aca-Mir-133-P4-v2  Ami-Mir-133-P1-v1  Ami-Mir-133-P1-v2  Ami-Mir-133-P2-v1  Ami-Mir-133-P2-v2  Ami-Mir-133-P3-v1  Ami-Mir-133-P3-v2  Ami-Mir-133-P4-v1  Ami-Mir-133-P4-v2  Asu-Mir-133  Bfl-Mir-133-v1  Bfl-Mir-133-v2  Bta-Mir-133-P1-v1  Bta-Mir-133-P1-v2  Bta-Mir-133-P2-v1  Bta-Mir-133-P2-v2  Bta-Mir-133-P3-v1  Bta-Mir-133-P3-v2  Cel-Mir-133  Cfa-Mir-133-P1-v1  Cfa-Mir-133-P1-v2  Cfa-Mir-133-P2-v1  Cfa-Mir-133-P2-v2  Cfa-Mir-133-P3-v1  Cfa-Mir-133-P3-v2  Cgi-Mir-133-v1  Cgi-Mir-133-v2  Cli-Mir-133-P1-v1  Cli-Mir-133-P1-v2  Cli-Mir-133-P2-v1  Cli-Mir-133-P2-v2  Cli-Mir-133-P3-v1  Cli-Mir-133-P3-v2  Cli-Mir-133-P4-v1  Cli-Mir-133-P4-v2  Cpi-Mir-133-P1-v1  Cpi-Mir-133-P1-v2  Cpi-Mir-133-P2-v1  Cpi-Mir-133-P2-v2  Cpi-Mir-133-P3-v1  Cpi-Mir-133-P3-v2  Cpi-Mir-133-P4-v1  Cpi-Mir-133-P4-v2  Cpo-Mir-133-P1-v1  Cpo-Mir-133-P1-v2  Cpo-Mir-133-P2-v1  Cpo-Mir-133-P2-v2  Cpo-Mir-133-P3-v1  Cpo-Mir-133-P3-v2  Cte-Mir-133  Dme-Mir-133  Dno-Mir-133-P1-v1  Dno-Mir-133-P1-v2  Dno-Mir-133-P2-v1  Dno-Mir-133-P2-v2  Dno-Mir-133-P3-v1  Dno-Mir-133-P3-v2  Dpu-Mir-133  Dre-Mir-133-P1-v1  Dre-Mir-133-P1-v2  Dre-Mir-133-P2-v1  Dre-Mir-133-P2-v2  Dre-Mir-133-P3a-v1  Dre-Mir-133-P3a-v2  Dre-Mir-133-P3b-v1  Dre-Mir-133-P3b-v2  Efe-Mir-133  Ete-Mir-133-P1-v1  Ete-Mir-133-P1-v2  Ete-Mir-133-P2-v1  Ete-Mir-133-P2-v2  Ete-Mir-133-P3-v1  Ete-Mir-133-P3-v2  Gga-Mir-133-P1-v1  Gga-Mir-133-P1-v2  Gga-Mir-133-P2-v1  Gga-Mir-133-P2-v2  Gga-Mir-133-P3-v1  Gga-Mir-133-P3-v2  Gga-Mir-133-P4-v1  Gga-Mir-133-P4-v2  Hsa-Mir-133-P1-v1  Hsa-Mir-133-P1-v2  Hsa-Mir-133-P2-v1  Hsa-Mir-133-P2-v2  Hsa-Mir-133-P3-v1  Hsa-Mir-133-P3-v2  Isc-Mir-133  Lgi-Mir-133  Mdo-Mir-133-P1-v1  Mdo-Mir-133-P1-v2  Mdo-Mir-133-P2-v1  Mdo-Mir-133-P2-v2  Mdo-Mir-133-P3-v1  Mdo-Mir-133-P3-v2  Mml-Mir-133-P1-v1  Mml-Mir-133-P1-v2  Mml-Mir-133-P2-v1  Mml-Mir-133-P2-v2  Mml-Mir-133-P3-v1  Mml-Mir-133-P3-v2  Mmu-Mir-133-P1-v1  Mmu-Mir-133-P1-v2  Mmu-Mir-133-P2-v1  Mmu-Mir-133-P2-v2  Mmu-Mir-133-P3-v1  Mmu-Mir-133-P3-v2  Ocu-Mir-133-P2-v1  Ocu-Mir-133-P2-v2  Ocu-Mir-133-P3-v1  Ocu-Mir-133-P3-v2  Pfl-Mir-133-v1  Pfl-Mir-133-v2  Pmi-Mir-133-P5a  Pmi-Mir-133-P5b  Rno-Mir-133-P1-v1  Rno-Mir-133-P1-v2  Rno-Mir-133-P2-v1  Rno-Mir-133-P2-v2  Rno-Mir-133-P3-v1  Rno-Mir-133-P3-v2  Sha-Mir-133-P1-v1  Sha-Mir-133-P1-v2  Sha-Mir-133-P2-v1  Sha-Mir-133-P2-v2  Sha-Mir-133-P3-v1  Sha-Mir-133-P3-v2  Sko-Mir-133-v1  Sko-Mir-133-v2  Spu-Mir-133  Xtr-Mir-133-P1-v1  Xtr-Mir-133-P1-v2  Xtr-Mir-133-P2-v1  Xtr-Mir-133-P2-v2  Xtr-Mir-133-P3-v1  Xtr-Mir-133-P3-v2  Xtr-Mir-133-P4-v1  Xtr-Mir-133-P4-v2 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(Tcas5.2)
LG5: 10558226-10558282 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UCACGACUUGGUUAGGCAAUGUGCAGCUUUAGCUGGUUGAAUCCGGGUCAAAUUGUAAAUGCUAUUUGGUCCCCUUCAACCAGCUGUGGUUGACAUUGCGAGCAACGAAACCGGUGA
Get precursor sequence
Structure
        10           20        30        40        50        
UCACGACUUGGUUAGGC---|    G     U            UCC  GU     UGUA 
                    AAUGU CAGCU UAGCUGGUUGAA   GG  CAAAU    A
                    UUACA GUUGG GUCGACCAACUU   CC  GUUUA    A
AGUGGCCAAAGCAACGAGCG^    -     U            CC-  UG     UCGU 
     110       100         90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Star sequence

Tca-Mir-133_5p*

MirBase accessionMIMAT0019116
Sequence
0- AGCUGGUUGAAUCCGGGUCAAAU -23
Get sequence
Mature sequence

Tca-Mir-133_3p

MirBase accessionMIMAT0008372
Sequence
35- UUGGUCCCCUUCAACCAGCUGU -57
Get sequence
Seed sequenceUGGUCCC