MirGeneDB

Gene name

Tca-Let-7

Family name LET-7 (all species)
MiRBase ID tca-let-7
Paralogues
Orthologues Aca-Let-7-P1  Aca-Let-7-P2  Aca-Let-7-P3  Aca-Let-7-P4  Aca-Let-7-P5  Aca-Let-7-P6  Aca-Let-7-P7  Aca-Let-7-P8  Aca-Let-7-P9  Aca-Let-7-P10  Aca-Let-7-P11  Aca-Let-7-P12  Aca-Let-7-P13  Aca-Let-7-P14  Ami-Let-7-P1  Ami-Let-7-P2  Ami-Let-7-P3  Ami-Let-7-P4  Ami-Let-7-P5  Ami-Let-7-P6  Ami-Let-7-P7  Ami-Let-7-P8  Ami-Let-7-P9  Ami-Let-7-P10  Ami-Let-7-P11  Ami-Let-7-P12  Ami-Let-7-P13  Ami-Let-7-P14  Asu-Let-7-P15  Asu-Let-7-P17  Bfl-Let-7-P20  Bfl-Let-7-P21  Bta-Let-7-P1  Bta-Let-7-P2  Bta-Let-7-P3  Bta-Let-7-P4  Bta-Let-7-P5  Bta-Let-7-P6  Bta-Let-7-P7  Bta-Let-7-P8  Bta-Let-7-P9  Bta-Let-7-P10  Bta-Let-7-P11  Bta-Let-7-P12  Cel-Let-7-P15  Cel-Let-7-P16  Cel-Let-7-P17  Cel-Let-7-P18  Cel-Let-7-P19  Cfa-Let-7-P1  Cfa-Let-7-P2  Cfa-Let-7-P3  Cfa-Let-7-P4  Cfa-Let-7-P5  Cfa-Let-7-P6  Cfa-Let-7-P7  Cfa-Let-7-P8  Cfa-Let-7-P9  Cfa-Let-7-P10  Cfa-Let-7-P11  Cgi-Let-7  Cli-Let-7-P1  Cli-Let-7-P3  Cli-Let-7-P4  Cli-Let-7-P5  Cli-Let-7-P6  Cli-Let-7-P7  Cli-Let-7-P8  Cli-Let-7-P11  Cli-Let-7-P12  Cli-Let-7-P13  Cli-Let-7-P14  Cpi-Let-7-P1  Cpi-Let-7-P2  Cpi-Let-7-P3  Cpi-Let-7-P4  Cpi-Let-7-P5  Cpi-Let-7-P6  Cpi-Let-7-P7  Cpi-Let-7-P8  Cpi-Let-7-P9  Cpi-Let-7-P10  Cpi-Let-7-P11  Cpi-Let-7-P12  Cpi-Let-7-P13  Cpi-Let-7-P14  Cpo-Let-7-P1  Cpo-Let-7-P2  Cpo-Let-7-P3  Cpo-Let-7-P4  Cpo-Let-7-P5  Cpo-Let-7-P6  Cpo-Let-7-P7  Cpo-Let-7-P8  Cpo-Let-7-P9  Cpo-Let-7-P10  Cpo-Let-7-P11  Cpo-Let-7-P12  Cte-Let-7  Dme-Let-7  Dno-Let-7-P1  Dno-Let-7-P3  Dno-Let-7-P4  Dno-Let-7-P5  Dno-Let-7-P6  Dno-Let-7-P7  Dno-Let-7-P8  Dno-Let-7-P9  Dno-Let-7-P10  Dno-Let-7-P11  Dno-Let-7-P12  Dpu-Let-7  Dre-Let-7-P1a  Dre-Let-7-P1b  Dre-Let-7-P2a  Dre-Let-7-P2b  Dre-Let-7-P3a  Dre-Let-7-P3b  Dre-Let-7-P5  Dre-Let-7-P6  Dre-Let-7-P7  Dre-Let-7-P8  Dre-Let-7-P9a  Dre-Let-7-P10a  Dre-Let-7-P10b  Dre-Let-7-P11  Dre-Let-7-P12  Dre-Let-7-P13a  Dre-Let-7-P13b  Dre-Let-7-P14a  Efe-Let-7-P22  Efe-Let-7-P23  Efe-Let-7-P24  Efe-Let-7-P25  Efe-Let-7-P26  Ete-Let-7-P1  Ete-Let-7-P2  Ete-Let-7-P3  Ete-Let-7-P4  Ete-Let-7-P5  Ete-Let-7-P6  Ete-Let-7-P7  Ete-Let-7-P8  Ete-Let-7-P9  Ete-Let-7-P10  Ete-Let-7-P11  Ete-Let-7-P12  Gga-Let-7-P1  Gga-Let-7-P3  Gga-Let-7-P4  Gga-Let-7-P5  Gga-Let-7-P6  Gga-Let-7-P7  Gga-Let-7-P8  Gga-Let-7-P11  Gga-Let-7-P12  Gga-Let-7-P13  Gga-Let-7-P14  Hsa-Let-7-P1  Hsa-Let-7-P2  Hsa-Let-7-P3  Hsa-Let-7-P4  Hsa-Let-7-P5  Hsa-Let-7-P6  Hsa-Let-7-P7  Hsa-Let-7-P8  Hsa-Let-7-P9  Hsa-Let-7-P10  Hsa-Let-7-P11  Hsa-Let-7-P12  Isc-Let-7  Lgi-Let-7  Mdo-Let-7-P1  Mdo-Let-7-P4  Mdo-Let-7-P5  Mdo-Let-7-P6  Mdo-Let-7-P7  Mdo-Let-7-P8  Mdo-Let-7-P10  Mdo-Let-7-P11  Mdo-Let-7-P12  Mml-Let-7-P1  Mml-Let-7-P2  Mml-Let-7-P3  Mml-Let-7-P4  Mml-Let-7-P5  Mml-Let-7-P6  Mml-Let-7-P7  Mml-Let-7-P8  Mml-Let-7-P9  Mml-Let-7-P10  Mml-Let-7-P11  Mml-Let-7-P12  Mmu-Let-7-P1  Mmu-Let-7-P2  Mmu-Let-7-P3  Mmu-Let-7-P4  Mmu-Let-7-P5  Mmu-Let-7-P6  Mmu-Let-7-P7  Mmu-Let-7-P8  Mmu-Let-7-P9  Mmu-Let-7-P10  Mmu-Let-7-P11  Mmu-Let-7-P12  Ocu-Let-7-P1  Ocu-Let-7-P3  Ocu-Let-7-P4  Ocu-Let-7-P5  Ocu-Let-7-P6  Ocu-Let-7-P7  Ocu-Let-7-P8  Ocu-Let-7-P9  Ocu-Let-7-P10  Ocu-Let-7-P11  Ocu-Let-7-P12  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P1  Rno-Let-7-P2  Rno-Let-7-P3  Rno-Let-7-P4  Rno-Let-7-P5  Rno-Let-7-P6  Rno-Let-7-P7  Rno-Let-7-P8  Rno-Let-7-P9  Rno-Let-7-P10  Rno-Let-7-P11  Rno-Let-7-P12  Sha-Let-7-P1  Sha-Let-7-P2  Sha-Let-7-P3  Sha-Let-7-P4  Sha-Let-7-P5  Sha-Let-7-P6  Sha-Let-7-P7  Sha-Let-7-P8  Sha-Let-7-P10  Sha-Let-7-P11  Sha-Let-7-P12  Sko-Let-7  Spu-Let-7  Xtr-Let-7-P2  Xtr-Let-7-P3  Xtr-Let-7-P6  Xtr-Let-7-P7  Xtr-Let-7-P8  Xtr-Let-7-P9  Xtr-Let-7-P10  Xtr-Let-7-P11  Xtr-Let-7-P12 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(Tcas5.2)
LG6: 4363426-4363492 [+] Ensembl
Clustered MiRNAs
(< 10kb from Let-7)
Mir-10-P2 LG6: 4363294-4363349 [+] Ensembl
Mir-10-P3 LG6: 4363618-4363677 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AAAAGUACUAGAUUUGUGGCAGGGUCUGUUUGAGGUAGUAGGUUGUAUAGUAAGUAUUACACCUAUUGGGAGUGCUGUACAGCCUGCUAACUUUCCCAGACCCGAGCCCUUUCAUCUGAGAAGACGC
Get precursor sequence
Structure
        10          20         30        40        50        60  
AAAAGUACUAGAUUUGU--   A-|      UUU   G                 AGUAUUACA 
                   GGC  GGGUCUG   GAG UAGUAGGUUGUAUAGUA         C
                   CCG  CCCAGAC   UUC AUCGUCCGACAUGUCGU         C
CGCAGAAGAGUCUACUUUC   AG^      CCU   A                 GAGGGUUAU 
     120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Mature sequence

Tca-Let-7_5p

MirBase accessionMIMAT0008354
Sequence
0- UGAGGUAGUAGGUUGUAUAGUAA -23
Get sequence
Seed sequenceGAGGUAG
Star sequence

Tca-Let-7_3p*

MirBase accessionMIMAT0019098
Sequence
44- CUGUACAGCCUGCUAACUUUCCC -67
Get sequence