MirGeneDB

MirGeneDB ID

Sko-Mir-193-P1d

Family name MIR-193 (all species)
Seed ACUGGCC
Species Saccoglossus (Saccoglossus kowalevskii)
MiRBase ID sko-mir-193b
Paralogues Sko-Mir-193-P1c  Sko-Mir-193-P2 
Orthologues Aae-Mir-193-P1  Bge-Mir-193-P1  Cbr-Mir-193-P1-v1  Cbr-Mir-193-P1-v2  Cel-Mir-193-P1-v1  Cel-Mir-193-P1-v2  Cgi-Mir-193-P1  Cte-Mir-193-P1  Dan-Mir-193-P1-v1  Dan-Mir-193-P1-v2  Dan-Mir-193-P1-v3  Dan-Mir-193-P1-v4  Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dme-Mir-193-P1-v3  Dme-Mir-193-P1-v4  Dmo-Mir-193-P1-v1  Dmo-Mir-193-P1-v2  Dmo-Mir-193-P1-v3  Dmo-Mir-193-P1-v4  Dpu-Mir-193-P1  Hme-Mir-193-P1  Isc-Mir-193-P1  Lgi-Mir-193-P1  Pfl-Mir-193-P1d  Pmi-Mir-193-P1  Tca-Mir-193-P1 
Node of Origin (locus) Enteropneusta
Node of Origin (family) Bilateria
Genome context
(Skow_1.1)
NW_003119955.1: 7997-8058 [+]
Clustered MiRNAs
(< 10kb from Mir-193-P1d)
Mir-193-P1c NW_003119955.1: 7658-7714 [+]
Mir-193-P1d NW_003119955.1: 7997-8058 [+]
Mir-193-P2 NW_003119955.1: 8988-9044 [+]
Precursor
(pre-Mir +30nt flank)
GAAAAUGUAGAAAAGCUGUUCAUAUGUUUUGGGGGUUUCUCUGGCCACAGUAUGAAACGUACAAUCCUCAUACUGGCCAGCGAAAUCCCAAAAACAGAAGAACAUUAUCAUCGAUUAAGUUC
Get precursor sequence
Structure
        10          20        30        40        50        60 
GAAAAUGUAGAAAAGCU--|   AUA      G        U       CA     AAACGU 
                   GUUC   UGUUUU GGGGUUUC CUGGCCA  GUAUG      A
                   CAAG   ACAAAA CCCUAAAG GACCGGU  CAUAC      C
CUUGAAUUAGCUACUAUUA^   AAG      A        C       --     UCCUAA 
120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sko-Mir-193-P1d_5p* (predicted)

MirBase accessionNone
Sequence
0- GGGGGUUUCUCUGGCCACAGUAUG -24
Get sequence
Mature sequence

Sko-Mir-193-P1d_3p

MirBase accessionMIMAT0009677
Sequence
40- UACUGGCCAGCGAAAUCCCAAA -62
Get sequence