MirGeneDB

MirGeneDB ID

Sko-Mir-193-P1c

Family name MIR-193 (all species)
Seed GGGAUUU
Species Saccoglossus (Saccoglossus kowalevskii)
MiRBase ID sko-mir-193a
Paralogues Sko-Mir-193-P1d  Sko-Mir-193-P2 
Orthologues Aae-Mir-193-P1  Bge-Mir-193-P1  Cbr-Mir-193-P1-v1  Cbr-Mir-193-P1-v2  Cel-Mir-193-P1-v1  Cel-Mir-193-P1-v2  Cgi-Mir-193-P1  Cte-Mir-193-P1  Dan-Mir-193-P1-v1  Dan-Mir-193-P1-v2  Dan-Mir-193-P1-v3  Dan-Mir-193-P1-v4  Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dme-Mir-193-P1-v3  Dme-Mir-193-P1-v4  Dmo-Mir-193-P1-v1  Dmo-Mir-193-P1-v2  Dmo-Mir-193-P1-v3  Dmo-Mir-193-P1-v4  Dpu-Mir-193-P1  Hme-Mir-193-P1  Isc-Mir-193-P1  Lgi-Mir-193-P1  Pfl-Mir-193-P1c  Pmi-Mir-193-P1  Tca-Mir-193-P1 
Node of Origin (locus) Enteropneusta
Node of Origin (family) Bilateria
Genome context
(Skow_1.1)
NW_003119955.1: 7658-7714 [+]
Clustered MiRNAs
(< 10kb from Mir-193-P1c)
Mir-193-P1c NW_003119955.1: 7658-7714 [+]
Mir-193-P1d NW_003119955.1: 7997-8058 [+]
Mir-193-P2 NW_003119955.1: 8988-9044 [+]
Precursor
(pre-Mir +30nt flank)
UACGCCGUGUAUUCGUUGCCAGCAUUGUUACGGGAUUUGAUUGAUCAGUUCAAGUGUUUUGUCUGAACUGGCCUUUUAAGUCCCGCAAUGUUGCUGGUGUUAUUCAGAAACAGAAAA
Get precursor sequence
Structure
        10          20        30        40        50        
UACGCCGUGUAUUCGUU--|      UU   A          UUGA        AGUGU 
                   GCCAGCA  GUU CGGGAUUUGA    UCAGUUCA     \
                   UGGUCGU  UAA GCCCUGAAUU    GGUCAAGU     U
AAAAGACAAAGACUUAUUG^      UG   C          UUCC        CUGUU 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
To
Mature sequence

Sko-Mir-193-P1c_5p

MirBase accessionMIMAT0019157
Sequence
0- CGGGAUUUGAUUGAUCAGUUCA -22
Get sequence
Co-mature sequence

Sko-Mir-193-P1c_3p

MirBase accessionMIMAT0009635
Sequence
35- AACUGGCCUUUUAAGUCCCGCA -57
Get sequence