MirGeneDB

Gene name

Sha-Mir-126-v1

Family name MIR-126 (all species)
Species Tasmanian devil (Sarcophilus harrissii)
MiRBase ID sha-mir-126
Paralogues Sha-Mir-126-v2  Sha-Mir-126-v3 
Orthologues Aca-Mir-126-v1  Ami-Mir-126-v1  Bta-Mir-126-v1  Cfa-Mir-126-v1  Cin-Mir-126-v1  Cli-Mir-126-v1  Cpi-Mir-126-v1  Cpo-Mir-126-v1  Dno-Mir-126-v1  Ete-Mir-126-v1  Gga-Mir-126-v1  Hsa-Mir-126-v1  Mdo-Mir-126-v1  Mml-Mir-126-v1  Mmu-Mir-126-v1  Oan-Mir-126-v1  Ocu-Mir-126-v1  Rno-Mir-126-v1  Sto-Mir-126-v1  Tgu-Mir-126-v1  Xtr-Mir-126-v1 
Node of Origin (locus) Olfactores
Node of Origin (family) Olfactores
Genome context
(DEVIL7_traces)
GL834949.1: 4285-4343 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-126-v1)
Mir-126-v2 GL834949.1: 4285-4343 [+] UCSC Ensembl
Mir-126-v3 GL834949.1: 4285-4343 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAAGGAAAUUCUGGGCCGCUGACGAUGGGUCAUUAUUACUUUUGGUACGCGCUGUGACACAUCAAACUCGUACCGUGAGUAAUAAUGCGCCAUUGGCAGCCUGGGCAGCAAGAAAGACG
Get precursor sequence
Structure
        10          20         30        40        50         
GAAGGAAAUUCUGGGCC--    A      -|U           U       CGCUGUGAC 
                   GCUG CGAUGG G CAUUAUUACUU UGGUACG         \
                   CGAC GUUACC C GUAAUAAUGAG GCCAUGC         A
GCAGAAAGAACGACGGGUC    G      G^-           U       UCAAACUAC 
       110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Br He Ki Li Ly Pa Sk Sp Te
Star sequence

Sha-Mir-126-v1_5p*

MirBase accessionNone
Sequence
0- CAUUAUUACUUUUGGUACGCG -21
Get sequence
Mature sequence

Sha-Mir-126-v1_3p

MirBase accessionMIMAT0022779
Sequence
38- CGUACCGUGAGUAAUAAUGCG -59
Get sequence
Seed sequenceGUACCGU