MirGeneDB

Gene name

Rno-Mir-216-P1a

Family name MIR-216 (all species)
MiRBase ID rno-mir-216a
Paralogues Rno-Mir-216-P1b 
Orthologues Aca-Mir-216-P1a  Ami-Mir-216-P1a  Asu-Mir-216-P1  Bfl-Mir-216-P1  Bta-Mir-216-P1a  Cel-Mir-216-P1  Cfa-Mir-216-P1a  Cgi-Mir-216-P1  Cli-Mir-216-P1a  Cpi-Mir-216-P1a  Cpo-Mir-216-P1a  Dme-Mir-216-P1  Dno-Mir-216-P1a  Dpu-Mir-216-P1  Dre-Mir-216-P1a  Efe-Mir-216-P1  Ete-Mir-216-P1a  Gga-Mir-216-P1a  Hsa-Mir-216-P1a  Isc-Mir-216-P1  Lgi-Mir-216-P1  Mdo-Mir-216-P1a  Mml-Mir-216-P1a  Mmu-Mir-216-P1a  Ocu-Mir-216-P1a  Sha-Mir-216-P1a  Tca-Mir-216-P1  Xtr-Mir-216-P1a 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(rn6)
chr14: 113112147-113112208 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-216-P1a)
Mir-217-v2 chr14: 113119559-113119619 [+] UCSC Ensembl
Mir-217-v1 chr14: 113119560-113119618 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGGUCCAACCUGGUUAGCUAUGAGUUAGUUUAAUCUCAGCUGGCAACUGUGAGAUGUCCCUAUCAUUCCUCACAGUGGUCUCUGGGAUUAUGCUAAACAGAGCAAUUUCCUUGACCUCCUGG
Get precursor sequence
Structure
        10           20        30        40        50        60 
AGGUCCAACCUGGUUAG---| A  AG     U         CU   A        AUGUCCC 
                    CU UG  UUAGU UAAUCUCAG  GGC ACUGUGAG       \
                    GA AC  AAUCG AUUAGGGUC  CUG UGACACUC       U
GGUCCUCCAGUUCCUUUAAC^ G  A-     U         U-   G        CUUACUA 
120       110       100         90         80        70
Deep sequencing
Go to detailed chart
CommentThis gene was named Mir-216-P1 in MirGene 1.0 but it appears that there are two ancestral copies of Mir-216 with the second copy found only in protostomes and the two copies in vertebrates a vertebrate-specific gene duplication of one of these two ancestral paralogues.
3' NTU No
MotifsNo
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-216-P1a_5p

MirBase accessionMIMAT0000886
Sequence
0- UAAUCUCAGCUGGCAACUGUGAG -23
Get sequence
Seed sequenceAAUCUCA
Validated targets microrna.org: MIMAT0000886
TargetScanVert: rno-miR-216a-5p
miRDB: MIMAT0000886
Star sequence

Rno-Mir-216-P1a_3p*

MirBase accessionMIMAT0017160
Sequence
40- CACAGUGGUCUCUGGGAUUAUG -62
Get sequence
Validated targets TargetScanVert: rno-miR-216a-3p
miRDB: MIMAT0017160