MirGeneDB

Gene name

Pfl-Mir-92-o44

Family name MIR-92 (all species)
MiRBase ID
Paralogues Pfl-Mir-92-o43  Pfl-Mir-92-o45  Pfl-Mir-92-o46  Pfl-Mir-92-o47 
Orthologues Asu-Mir-92  Cel-Mir-92  Isc-Mir-92 
Node of Origin (gene) P. flava
Node of Origin (family) Bilateria
Genome context
(Pfl)
LD343282.1: 115958-116021 [+]
Precursor
(pre-Mir +30nt flank)
CCUAAAGUAUGUUAUCUGGUCGGACUGUAUAGGUUGGGACUUUUGCAAUUUCCUUCGAUAAUAUGACAGAGAUAUUGCACUCGUCCCGGCCUGUAUGUCGCGACUAUGCUCAUCCAUUGCGUGC
Get precursor sequence
Structure
        10          20         30        40        50        60 
CCUAAAGUAUGUUAUCU--     -|  U              UUU      U  CUUCGAUA 
                   GGUCG GAC GUAUAGGUUGGGAC   UGCAAU UC        A
                   UCAGC CUG UAUGUCCGGCCCUG   ACGUUA AG        U
CGUGCGUUACCUACUCGUA     G^  -              CUC      U  AGACAGUA 
  120       110       100         90        80        70
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Pt
Star sequence

Pfl-Mir-92-o44_5p*

MirBase accessionNone
Sequence
0- AGGUUGGGACUUUUGCAAUUUC -22
Get sequence
Mature sequence

Pfl-Mir-92-o44_3p

MirBase accessionNone
Sequence
42- UAUUGCACUCGUCCCGGCCUGU -64
Get sequence
Seed sequenceAUUGCAC