MirGeneDB

Gene name

Pfl-Mir-9-v1

Family name MIR-9 (all species)
MiRBase ID
Paralogues Pfl-Mir-9-v2 
Orthologues Cte-Mir-9  Isc-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Sko-Mir-9-v1  Spu-Mir-9 
Node of Origin (gene) Enteropneusta
Node of Origin (family) Bilateria
Genome context
(Pfl)
LD344854.1: 129993-130052 [+]
Precursor
(pre-Mir +30nt flank)
GGUGCACCGACAAGUCUGGCGCUCGUUUUCUCUUUGGUUAUCUAGCUGUAUGAGUGUUCUAGACAUUAUAAAGCUAGGUUACCAAAGACAAAAACAGAUGCCGUAAUUCAACUGAACACU
Get precursor sequence
Structure
        10         20         30         40        50         
GGUGCACCGACAAGUCU-    -| C     C-        U        G     GUGUU 
                  GGCG CU GUUUU  UCUUUGGU AUCUAGCU UAUGA     C
                  CCGU GA CAAAA  AGAAACCA UGGAUCGA AUAUU     U
UCACAAGUCAACUUAAUG    A^ -     AC        U        A     ACAGA 
.       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
Pt
Mature sequence

Pfl-Mir-9-v1_5p

MirBase accessionNone
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
Seed sequenceCUUUGGU
Co-mature sequence

Pfl-Mir-9-v1_3p

MirBase accessionNone
Sequence
37- AUAAAGCUAGGUUACCAAAGACA -60
Get sequence
Seed sequenceUAAAGCU