MirGeneDB

Gene name

Pfl-Mir-4830-P5

Family name MIR-4830 (all species)
MiRBase ID
Paralogues Pfl-Mir-4830-P6  Pfl-Mir-4830-P7  Pfl-Mir-4830-P8 
Orthologues
Node of Origin (gene) P. flava
Node of Origin (family) Enteropneusta
Genome context
(Pfl)
LD353158.1: 295072-295133 [-]
Precursor
(pre-Mir +30nt flank)
GGCCAAGAUUAGAAAUUGAGUGUUAUGGUGUCUCUUGAGAGCCAUAUGGAGGAGUUAACGGUGAUAGUUCCUCCGUAGGCUUUCAGGAAAUACCAUUUCGCUUCAUGAUUGUCCGGUUGUGC
Get precursor sequence
Structure
        10          20        30        40        50        60 
GGCCAAGAUUAGAAAUU--|    UU       C           A        AGUUAACG 
                   GAGUG  AUGGUGU UCUUGAGAGCC UAUGGAGG        \
                   UUCGC  UACCAUA AGGACUUUCGG AUGCCUCC        G
CGUGUUGGCCUGUUAGUAC^    UU       A           -        UUGAUAGU 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUG at 5p(-14)
Tissue expression
 +
Pt
Mature sequence

Pfl-Mir-4830-P5_5p

MirBase accessionNone
Sequence
0- UCUCUUGAGAGCCAUAUGGAGG -22
Get sequence
Seed sequenceCUCUUGA
Star sequence

Pfl-Mir-4830-P5_3p* (predicted)

MirBase accessionNone
Sequence
41- UCCGUAGGCUUUCAGGAAAUA -62
Get sequence