MirGeneDB

Gene name

Pfl-Mir-4829-P3

Family name MIR-4829 (all species)
MiRBase ID
Paralogues Pfl-Mir-4829-P1  Pfl-Mir-4829-P2 
Orthologues Sko-Mir-4829-P3 
Node of Origin (gene) Enteropneusta
Node of Origin (family) Hemichordata
Genome context
(Pfl)
LD533351.1: 110032-110091 [+]
Precursor
(pre-Mir +30nt flank)
AUUUAUUUCCACUGUUCUAGGGGGCUGGUUCAGGUAUUGGAAAAAGCACGUUGAACUCCCUAGACAAAUGUACUUUUCCCAAUGCCGGGGCCAUCUUCUAACACAGCGUCGUCAAUGGCU
Get precursor sequence
Structure
        10           20        30        40        50         
AUUUAUUUCCACUGUUC---|      C      A        A     C     GAACUC 
                    UAGGGGG UGGUUC GGUAUUGG AAAAG ACGUU      C
                    AUCUUCU ACCGGG CCGUAACC UUUUC UGUAA      C
UCGGUAACUGCUGCGACACA^      -      G        C     A     ACAGAU 
.       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Pt
Star sequence

Pfl-Mir-4829-P3_5p*

MirBase accessionNone
Sequence
0- CAGGUAUUGGAAAAAGCACGUU -22
Get sequence
Mature sequence

Pfl-Mir-4829-P3_3p

MirBase accessionNone
Sequence
38- UGUACUUUUCCCAAUGCCGGGG -60
Get sequence
Seed sequenceGUACUUU