MirGeneDB

Gene name

Pfl-Mir-4829-P2

Family name MIR-4829 (all species)
MiRBase ID
Paralogues Pfl-Mir-4829-P1  Pfl-Mir-4829-P3 
Orthologues Sko-Mir-4829-P2 
Node of Origin (gene) Enteropneusta
Node of Origin (family) Hemichordata
Genome context
(Pfl)
LD533351.1: 109641-109700 [+]
Precursor
(pre-Mir +30nt flank)
CACAGAGUCCAAUUGUUGUAGGGGUUGAGGCAGACAUUCGCAAGAGCACAUUUUGACACUAACAAUAAUGUACUCUUCCUAAUGCCUGGCUCACUCUCUAGCCCUUGUCAACACCUGGUU
Get precursor sequence
Structure
        10          20        30        40        50         
CACAGAGUCCAAUUGUUG--|    GU    G   A    CGC     C     UUGACA 
                    UAGGG  UGAG CAG CAUU   AAGAG ACAUU      C
                    AUCUC  ACUC GUC GUAA   UUCUC UGUAA      U
UUGGUCCACAACUGUUCCCG^    UC    G   C    UCC     A     UAACAA 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Pt
Star sequence

Pfl-Mir-4829-P2_5p*

MirBase accessionNone
Sequence
0- CAGACAUUCGCAAGAGCACAUU -22
Get sequence
Mature sequence

Pfl-Mir-4829-P2_3p

MirBase accessionNone
Sequence
38- UGUACUCUUCCUAAUGCCUGGC -60
Get sequence
Seed sequenceGUACUCU