MirGeneDB

Gene name

Pfl-Mir-4828-P1

Family name MIR-4828 (all species)
MiRBase ID
Paralogues Pfl-Mir-4828-P2  Pfl-Mir-4828-P3 
Orthologues Sko-Mir-4828-P1 
Node of Origin (gene) Enteropneusta
Node of Origin (family) Hemichordata
Genome context
(Pfl)
LD343010.1: 765739-765802 [-]
Precursor
(pre-Mir +30nt flank)
AGCUGCCGAUUAACUUUUGGAGUGACCUUUCAGUCUGAUUGGUAUUUUCAUCUGUUGGUAAAAUAGCCAUACAGUAAAUACCAUUCAGAUUGCAAGGUUAUCCCUAAAAUCUUCACUUUUUGGG
Get precursor sequence
Structure
        10          20        30        40        50        60 
AGCUGCCGAUUAACUUUU--| AG       U        U        UCAUCUGUUGGUA 
                    GG  UGACCUU CAGUCUGA UGGUAUUU             A
                    CC  AUUGGAA GUUAGACU ACCAUAAA             A
GGGUUUUUCACUUCUAAAAU^ CU       C        U        UGACAUACCGAUA 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Pt
Star sequence

Pfl-Mir-4828-P1_5p* (predicted)

MirBase accessionNone
Sequence
0- CAGUCUGAUUGGUAUUUUCAUC -22
Get sequence
Mature sequence

Pfl-Mir-4828-P1_3p

MirBase accessionNone
Sequence
42- AGUAAAUACCAUUCAGAUUGCA -64
Get sequence
Seed sequenceGUAAAUA