MirGeneDB

Gene name

Pfl-Mir-4826

Family name MIR-4826 (all species)
MiRBase ID
Paralogues
Orthologues Sko-Mir-4826 
Node of Origin (gene) Enteropneusta
Node of Origin (family) Enteropneusta
Genome context
(Pfl)
LD343550.1: 44743-44809 [-]
Precursor
(pre-Mir +30nt flank)
GAAGACUGAGAUAUGUUUGUUGCUACUGAUCAUCCGAUAACAAGUGUUGGAUAGGGAAUAAUAAUAAGUACGAAUCCAACACUUCCAAUCGGAUCGUCUGUAGUGAUACCGAACAUCUGUAGAAUUG
Get precursor sequence
Structure
        10          20        30        40        50        60   
GAAGACUGAGAUAUGUU--|  UG    U   C       AAC           AGGGAAUAAU 
                   UGU  CUAC GAU AUCCGAU   AAGUGUUGGAU          \
                   AUA  GAUG CUG UAGGCUA   UUCACAACCUA          A
GUUAAGAUGUCUACAAGCC^  GU    U   C       ACC           AGCAUGAAUA 
     120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site + on the 3p arm relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Pt
Mature sequence

Pfl-Mir-4826_5p

MirBase accessionNone
Sequence
0- CAUCCGAUAACAAGUGUUGGAU -22
Get sequence
Seed sequenceAUCCGAU
Star sequence

Pfl-Mir-4826_3p*

MirBase accessionNone
Sequence
45- CCAACACUUCCAAUCGGAUCGU -67
Get sequence