MirGeneDB

Gene name

Pfl-Mir-4819

Family name MIR-4819 (all species)
MiRBase ID
Paralogues
Orthologues Sko-Mir-4819 
Node of Origin (gene) Enteropneusta
Node of Origin (family) Enteropneusta
Genome context
(Pfl)
LD344947.1: 75194-75252 [+]
Precursor
(pre-Mir +30nt flank)
CCGAUCGCCUUUGAUUCGAUAAUUGCCCUCACUUGGACAUAAUGGAUGCGAGUUUGUAAAACCAUCUCGCGUCCGUUCUGUUCAUGAGUGGGAGUUAUUUUAAAACGCAACUUCGGAAA
Get precursor sequence
Structure
        10           20         30        40        50         
CCGAUCGCCUUUGAUUC---       G  -|   CU      U            UUUGUA 
                    GAUAAUU CC CUCA  UGGACA AAUGGAUGCGAG      \
                    UUAUUGA GG GAGU  ACUUGU UUGCCUGCGCUC      A
AAAGGCUUCAACGCAAAAUU       G  U^   --      C            UACCAA 
       110       100        90          80        70        60
Deep sequencing
Go to detailed chart
CommentThere are multiple Dicer sites on the 3p arm +1 and +3 relative to what is annotate here.
3' NTU No
MotifsNo
Tissue expression
 +
Pt
Mature sequence

Pfl-Mir-4819_5p

MirBase accessionNone
Sequence
0- ACUUGGACAUAAUGGAUGCGAG -22
Get sequence
Seed sequenceCUUGGAC
Star sequence

Pfl-Mir-4819_3p*

MirBase accessionNone
Sequence
37- CGCGUCCGUUCUGUUCAUGAGU -59
Get sequence