MirGeneDB

Gene name

Pfl-Mir-4818-P7

Family name MIR-4818 (all species)
MiRBase ID
Paralogues Pfl-Mir-4818-P1  Pfl-Mir-4818-P2  Pfl-Mir-4818-P4  Pfl-Mir-4818-P5  Pfl-Mir-4818-P6 
Orthologues Sko-Mir-4818-P7 
Node of Origin (gene) Enteropneusta
Node of Origin (family) Hemichordata
Genome context
(Pfl)
LD345931.1: 65230-65289 [-]
Precursor
(pre-Mir +30nt flank)
AGGAAAAACAAGAAUGUGUUGAGCUUGAAACUCCACUAUUGAGUGCUAUUAGUGUGUUAUUUGUAUCUGAUUGCACGCAAUAGUGGGGCUCCACACUCCAACCCUUUACCAACUGUAUAC
Get precursor sequence
Structure
        10         20         30        40        50         
AGGAAAAACAAGAAUGU-   -|  CU  AAA           A    U     UGUGUU 
                  GUU GAG  UG   CUCCACUAUUG GUGC AUUAG      A
                  CAA CUC  AC   GGGGUGAUAAC CACG UAGUC      U
CAUAUGUCAACCAUUUCC   C^  AC  CUC           G    U     UAUGUU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
Pt
Star sequence

Pfl-Mir-4818-P7_5p*

MirBase accessionNone
Sequence
0- CUCCACUAUUGAGUGCUAUUAG -22
Get sequence
Mature sequence

Pfl-Mir-4818-P7_3p

MirBase accessionNone
Sequence
38- GAUUGCACGCAAUAGUGGGGCU -60
Get sequence
Seed sequenceAUUGCAC