MirGeneDB

Gene name

Pfl-Mir-34

Family name MIR-34 (all species)
MiRBase ID
Paralogues
Orthologues Aca-Mir-34-P1  Aca-Mir-34-P2a  Aca-Mir-34-P2b  Aca-Mir-34-P3a  Aca-Mir-34-P3c  Aca-Mir-34-P3d  Ami-Mir-34-P1  Ami-Mir-34-P2a  Ami-Mir-34-P2b  Ami-Mir-34-P3a  Ami-Mir-34-P3b  Ami-Mir-34-P3c  Ami-Mir-34-P3d  Asu-Mir-34  Bfl-Mir-34-P5a  Bfl-Mir-34-P5b  Bfl-Mir-34-P6  Bfl-Mir-34-P6a  Bfl-Mir-34-P6b  Bfl-Mir-34-P7a  Bfl-Mir-34-P7b  Bta-Mir-34-P1  Bta-Mir-34-P2a  Bta-Mir-34-P2b  Bta-Mir-34-P3a  Bta-Mir-34-P3b  Bta-Mir-34-P3c  Cel-Mir-34  Cfa-Mir-34-P1  Cfa-Mir-34-P2a-v1  Cfa-Mir-34-P2a-v2  Cfa-Mir-34-P2b  Cfa-Mir-34-P3a  Cfa-Mir-34-P3b  Cgi-Mir-34  Cli-Mir-34-P1  Cli-Mir-34-P2a  Cli-Mir-34-P2b  Cli-Mir-34-P3a  Cli-Mir-34-P3b  Cli-Mir-34-P3c  Cli-Mir-34-P3d  Cpi-Mir-34-P1  Cpi-Mir-34-P2a  Cpi-Mir-34-P2b  Cpi-Mir-34-P3a  Cpi-Mir-34-P3b  Cpi-Mir-34-P3c  Cpi-Mir-34-P3d  Cpo-Mir-34-P1  Cpo-Mir-34-P2a  Cpo-Mir-34-P2b  Cpo-Mir-34-P3a  Cpo-Mir-34-P3c  Cte-Mir-34  Dme-Mir-34  Dno-Mir-34-P1  Dno-Mir-34-P2a  Dno-Mir-34-P2b  Dno-Mir-34-P3a  Dno-Mir-34-P3c  Dpu-Mir-34  Dre-Mir-34-P1  Dre-Mir-34-P2a  Dre-Mir-34-P2b  Efe-Mir-34  Ete-Mir-34-P1  Ete-Mir-34-P2a  Ete-Mir-34-P2b  Ete-Mir-34-P3a  Ete-Mir-34-P3b  Gga-Mir-34-P1  Gga-Mir-34-P2a  Gga-Mir-34-P2b  Gga-Mir-34-P3a  Gga-Mir-34-P3b  Gga-Mir-34-P3c  Gga-Mir-34-P3d  Hsa-Mir-34-P1  Hsa-Mir-34-P2a  Hsa-Mir-34-P2b  Hsa-Mir-34-P3a  Hsa-Mir-34-P3b  Hsa-Mir-34-P3c  Lgi-Mir-34  Mdo-Mir-34-P1  Mdo-Mir-34-P2a  Mdo-Mir-34-P2b  Mdo-Mir-34-P3a  Mdo-Mir-34-P3b  Mdo-Mir-34-P3d  Mml-Mir-34-P1  Mml-Mir-34-P2a  Mml-Mir-34-P2b  Mml-Mir-34-P3a  Mml-Mir-34-P3b  Mmu-Mir-34-P1  Mmu-Mir-34-P2a  Mmu-Mir-34-P2b  Mmu-Mir-34-P3a  Mmu-Mir-34-P3b  Mmu-Mir-34-P3c  Ocu-Mir-34-P1  Ocu-Mir-34-P2a  Ocu-Mir-34-P2b  Ocu-Mir-34-P3a  Ocu-Mir-34-P3b  Pmi-Mir-34  Rno-Mir-34-P1  Rno-Mir-34-P2a  Rno-Mir-34-P2b  Rno-Mir-34-P3a  Rno-Mir-34-P3b  Rno-Mir-34-P3c  Sha-Mir-34-P1  Sha-Mir-34-P2a  Sha-Mir-34-P2b  Sha-Mir-34-P3a  Sha-Mir-34-P3b  Sha-Mir-34-P3d  Sko-Mir-34  Spu-Mir-34  Tca-Mir-34  Xtr-Mir-34-P1  Xtr-Mir-34-P2a1  Xtr-Mir-34-P2a2  Xtr-Mir-34-P2a3  Xtr-Mir-34-P2a4  Xtr-Mir-34-P2b  Xtr-Mir-34-P3a  Xtr-Mir-34-P3b  Xtr-Mir-34-P3c 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(Pfl)
LD524815.1: 31840-31898 [-]
Precursor
(pre-Mir +30nt flank)
AUGGUUCACCAAUUAUUGCAUGCUAUGAUAUGGCAGUGUGGUUAGCUGGUUGAUGAUGAUAAAUUUCAACAGCUAUCCGAGCUGCCCAUAUUAUGGUGUGAAUUAUCGUCGGUCCUUCU
Get precursor sequence
Structure
        10         20        30         40        50         
AUGGUUCACCAAUUAUUG-             -|     G   U      G   AUGAUG 
                   CAUGCUAUGAUAU GGCAGU UGG UAGCUG UUG      A
                   GUGUGGUAUUAUA CCGUCG GCC AUCGAC AAC      U
UCUUCCUGGCUGCUAUUAA             C^     A   U      -   UUUAAA 
       110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Pt
Mature sequence

Pfl-Mir-34_5p

MirBase accessionNone
Sequence
0- UGGCAGUGUGGUUAGCUGGUUG -22
Get sequence
Seed sequenceGGCAGUG
Star sequence

Pfl-Mir-34_3p* (predicted)

MirBase accessionNone
Sequence
38- ACAGCUAUCCGAGCUGCCCAU -59
Get sequence