MirGeneDB

Gene name

Pfl-Mir-242

Family name MIR-242 (all species)
MiRBase ID
Paralogues
Orthologues Bfl-Mir-242  Cel-Mir-242  Cgi-Mir-242  Cte-Mir-242  Lgi-Mir-242-P1  Lgi-Mir-242-P2  Pmi-Mir-242  Sko-Mir-242  Spu-Mir-242 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(Pfl)
LD346879.1: 366091-366150 [+]
Precursor
(pre-Mir +30nt flank)
GGUCACGUGACAUGUCUCACUUCAAUGUGUUGCGUAGGCGUUGUGCACAGUGAUGUGUGGCCCGGUUCCUGUGCAUCUCUCCCACGCAUAUCGUUGGAGUGAAUUUUCAUCGGGGAAGAA
Get precursor sequence
Structure
        10          20        30        40        50         
GGUCACGUGACAUGUCU--|         UGU     A  CGUU        UGAUGUGU 
                   CACUUCAAUG   UGCGU GG    GUGCACAG        G
                   GUGAGGUUGC   ACGCA CC    UACGUGUC        G
AAGAAGGGGCUACUUUUAA^         UAU     C  UCUC        CUUGGCCC 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
Pt
Mature sequence

Pfl-Mir-242_5p

MirBase accessionNone
Sequence
0- UGCGUAGGCGUUGUGCACAGU -21
Get sequence
Seed sequenceGCGUAGG
Star sequence

Pfl-Mir-242_3p* (predicted)

MirBase accessionNone
Sequence
38- CUGUGCAUCUCUCCCACGCAUA -60
Get sequence