MirGeneDB

Gene name

Pfl-Mir-2012

Family name MIR-2012 (all species)
MiRBase ID
Paralogues
Orthologues Pmi-Mir-2012  Sko-Mir-2012  Spu-Mir-2012 
Node of Origin (gene) Ambulacraria
Node of Origin (family) Ambulacraria
Genome context
(Pfl)
LD344014.1: 121392-121453 [+]
Precursor
(pre-Mir +30nt flank)
AGCCACGAUUAUCAUUUAUAUCUUACCCAGUAGUACUGGCAUAUGGACAUUGGUAUGCAUUGAAACCCCAGUGUUCAUAUUCCAGUACAGCCAGGUGAGGUAUCAUAAGCGCACACAUCCAG
Get precursor sequence
Structure
        10          20        30        40        50        60
AGCCACGAUUAUCAUUU--|         CA  A       C            GUAUGCA 
                   AUAUCUUACC  GU GUACUGG AUAUGGACAUUG       U
                   UAUGGAGUGG  CG CAUGACC UAUACUUGUGAC       U
GACCUACACACGCGAAUAC^         AC  A       U            CCCAAAG 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsNo
Tissue expression
 +
Pt
Mature sequence

Pfl-Mir-2012_5p

MirBase accessionNone
Sequence
0- UAGUACUGGCAUAUGGACAUUG -22
Get sequence
Seed sequenceAGUACUG
Star sequence

Pfl-Mir-2012_3p* (predicted)

MirBase accessionNone
Sequence
40- GUGUUCAUAUUCCAGUACAGCC -62
Get sequence