MirGeneDB

Gene name

Pfl-Mir-2008

Family name MIR-2008 (all species)
MiRBase ID
Paralogues
Orthologues Pmi-Mir-2008  Sko-Mir-2008-v1  Sko-Mir-2008-v2  Spu-Mir-2008 
Node of Origin (gene) Ambulacraria
Node of Origin (family) Ambulacraria
Genome context
(Pfl)
LD526296.1: 136777-136837 [-]
Precursor
(pre-Mir +30nt flank)
GUAUGUACGUUGUAGCUUCAUUUUUUACCCCGUAUUAACACUGAGGUUGAUGUUCGAUUUGUGAUACCAUCAGCCUCGCUGUCAAUACGGCGUAAGGGAUGGUAUUCGUCACGCCUCCUGU
Get precursor sequence
Structure
        10          20        30        40        50          
GUAUGUACGUUGUAGCU--|          C       A   C           UUCGAUU 
                   UCAUUUUUUAC CCGUAUU ACA UGAGGUUGAUG       \
                   GGUAGGGAAUG GGCAUAA UGU GCUCCGACUAC       U
UGUCCUCCGCACUGCUUAU^          C       C   C           CAUAGUG 
 .       110       100        90        80        70
Deep sequencing
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
Pt
Star sequence

Pfl-Mir-2008_5p* (predicted)

MirBase accessionNone
Sequence
0- CGUAUUAACACUGAGGUUGAUG -22
Get sequence
Mature sequence

Pfl-Mir-2008_3p (predicted)

MirBase accessionNone
Sequence
39- UCAGCCUCGCUGUCAAUACGGC -61
Get sequence
Seed sequenceCAGCCUC