MirGeneDB

Gene name

Pfl-Mir-2006

Family name MIR-2006 (all species)
MiRBase ID
Paralogues
Orthologues Pmi-Mir-2006  Sko-Mir-2006  Spu-Mir-2006 
Node of Origin (gene) Ambulacraria
Node of Origin (family) Ambulacraria
Genome context
(Pfl)
LD527063.1: 34000-34058 [-]
Precursor
(pre-Mir +30nt flank)
GUUCAGGAAUUCUUCUAUGCAAAUGAGCAACAUCGCUAUAAAGUGUUCUUAUUAUGUAAUAAUUCAUAAGCACACUACAUAGCGGUGCUACUCGUUGUAAUCAAUCGACGAUCCGUGAG
Get precursor sequence
Structure
        10           20        30        40        50         
GUUCAGGAAUUCUUCUA---|    A    CAA         AA     U     UAUGUA 
                    UGCAA UGAG   CAUCGCUAU  AGUGU CUUAU      \
                    AUGUU GCUC   GUGGCGAUA  UCACA GAAUA      A
GAGUGCCUAGCAGCUAACUA^    -    AUC         CA     C     CUUAAU 
       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Pt
Star sequence

Pfl-Mir-2006_5p*

MirBase accessionNone
Sequence
0- CAUCGCUAUAAAGUGUUCUUAU -22
Get sequence
Mature sequence

Pfl-Mir-2006_3p

MirBase accessionNone
Sequence
37- AAGCACACUACAUAGCGGUGCU -59
Get sequence
Seed sequenceAGCACAC