MirGeneDB

MirGeneDB ID

Pfl-Mir-193-P1d

Family name MIR-193 (all species)
Seed ACUGGCC
Species Ptychodera (Ptychodera flava)
MiRBase ID
Paralogues Pfl-Mir-193-P1c  Pfl-Mir-193-P2 
Orthologues Aae-Mir-193-P1  Bge-Mir-193-P1  Cbr-Mir-193-P1-v1  Cbr-Mir-193-P1-v2  Cel-Mir-193-P1-v1  Cel-Mir-193-P1-v2  Cgi-Mir-193-P1  Cte-Mir-193-P1  Dan-Mir-193-P1-v1  Dan-Mir-193-P1-v2  Dan-Mir-193-P1-v3  Dan-Mir-193-P1-v4  Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dme-Mir-193-P1-v3  Dme-Mir-193-P1-v4  Dmo-Mir-193-P1-v1  Dmo-Mir-193-P1-v2  Dmo-Mir-193-P1-v3  Dmo-Mir-193-P1-v4  Dpu-Mir-193-P1  Hme-Mir-193-P1  Isc-Mir-193-P1  Lgi-Mir-193-P1  Pmi-Mir-193-P1  Sko-Mir-193-P1d  Tca-Mir-193-P1 
Node of Origin (locus) Enteropneusta
Node of Origin (family) Bilateria
Genome context
(Pfl)
LD349275.1: 115517-115576 [+]
Precursor
(pre-Mir +30nt flank)
CUUUGGGGUUGCUCACUGCUUGCGUGAUUUUGGGGUCUCACCGGCCACUAUAUGUUGCUGUGCUCUCAUACUGGCCAGCGAAAUCCCAAAGUCACACAAGCAUUAUCGUCUGCUGACAGA
Get precursor sequence
Structure
        10          20        30        40        50        60
CUUUGGGGUUGCUCACU--|    C             C  ACC     CUA    UUGCU 
                   GCUUG GUGAUUUUGGGGU UC   GGCCA   UAUG     G
                   CGAAC CACUGAAACCCUA AG   CCGGU   AUAC     U
AGACAGUCGUCUGCUAUUA^    A             A  CGA     C--    UCUCG 
.       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Pt
Star sequence

Pfl-Mir-193-P1d_5p* (predicted)

MirBase accessionNone
Sequence
0- UGGGGUCUCACCGGCCACUAUAUG -24
Get sequence
Mature sequence

Pfl-Mir-193-P1d_3p

MirBase accessionNone
Sequence
38- UACUGGCCAGCGAAAUCCCAAA -60
Get sequence