MirGeneDB

Gene name

Pfl-Mir-1

Family name MIR-1 (all species)
MiRBase ID
Paralogues
Orthologues Aca-Mir-1-P1  Aca-Mir-1-P2  Aca-Mir-1-P3  Aca-Mir-1-P4  Ami-Mir-1-P1  Ami-Mir-1-P2  Ami-Mir-1-P3  Ami-Mir-1-P4  Asu-Mir-1  Bfl-Mir-1  Bta-Mir-1-P1  Bta-Mir-1-P2  Bta-Mir-1-P3  Cel-Mir-1  Cfa-Mir-1-P1  Cfa-Mir-1-P2  Cfa-Mir-1-P3  Cgi-Mir-1  Cli-Mir-1-P1  Cli-Mir-1-P2  Cli-Mir-1-P3  Cli-Mir-1-P4  Cpi-Mir-1-P1  Cpi-Mir-1-P2  Cpi-Mir-1-P3  Cpi-Mir-1-P4  Cpo-Mir-1-P1  Cpo-Mir-1-P2  Cpo-Mir-1-P3  Cte-Mir-1  Dme-Mir-1  Dno-Mir-1-P1  Dno-Mir-1-P2  Dno-Mir-1-P3  Dpu-Mir-1  Dre-Mir-1-P1  Dre-Mir-1-P2  Dre-Mir-1-P3a  Dre-Mir-1-P3b  Efe-Mir-1-P5  Efe-Mir-1-P6  Efe-Mir-1-P7  Efe-Mir-1-P8  Ete-Mir-1-P1  Ete-Mir-1-P2  Ete-Mir-1-P3  Gga-Mir-1-P1  Gga-Mir-1-P2  Gga-Mir-1-P3  Gga-Mir-1-P4  Hsa-Mir-1-P1  Hsa-Mir-1-P2  Hsa-Mir-1-P3  Isc-Mir-1  Lgi-Mir-1  Mdo-Mir-1-P1  Mdo-Mir-1-P2  Mdo-Mir-1-P3  Mml-Mir-1-P1  Mml-Mir-1-P2  Mml-Mir-1-P3  Mmu-Mir-1-P1  Mmu-Mir-1-P2  Mmu-Mir-1-P3  Ocu-Mir-1-P1  Ocu-Mir-1-P2  Ocu-Mir-1-P3  Pmi-Mir-1  Rno-Mir-1-P1  Rno-Mir-1-P2  Rno-Mir-1-P3  Sha-Mir-1-P1  Sha-Mir-1-P2  Sha-Mir-1-P3  Sko-Mir-1  Spu-Mir-1  Tca-Mir-1  Xtr-Mir-1-P1  Xtr-Mir-1-P2  Xtr-Mir-1-P3  Xtr-Mir-1-P4 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(Pfl)
LD345073.1: 123485-123547 [+]
Precursor
(pre-Mir +30nt flank)
UUGGGAAUGGUACAUUAUCCCGUUUACAGAACAUACUUCCUUAUCACUCCAUACCUGCUUUGGAAUCUGUAUGGAAUGUAAUGAAGUAUGUAUUGUUAGUCGGGAAGGAGUCUUCCUUGCUUC
Get precursor sequence
Structure
        10         20         30        40        50        60 
UUGGGAAUGGUACAUUA-     UUU-|   A         C   U  C      CCUGCUU 
                  UCCCG    ACAG ACAUACUUC UUA CA UCCAUA       U
                  AGGGC    UGUU UGUAUGAAG AAU GU AGGUAU       G
CUUCGUUCCUUCUGAGGA     UGAU^   A         U   -  A      GUCUAAG 
 120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Pt
Star sequence

Pfl-Mir-1_5p*

MirBase accessionNone
Sequence
0- ACAUACUUCCUUAUCACUCCAUA -23
Get sequence
Mature sequence

Pfl-Mir-1_3p

MirBase accessionNone
Sequence
41- UGGAAUGUAAUGAAGUAUGUAU -63
Get sequence
Seed sequenceGGAAUGU