MirGeneDB

Gene name

Ocu-Mir-216-P1a

Family name MIR-216 (all species)
MiRBase ID ocu-mir-216a
Paralogues Ocu-Mir-216-P1b 
Orthologues Aca-Mir-216-P1a  Ami-Mir-216-P1a  Asu-Mir-216-P1  Bfl-Mir-216-P1  Bta-Mir-216-P1a  Cel-Mir-216-P1  Cfa-Mir-216-P1a  Cgi-Mir-216-P1  Cli-Mir-216-P1a  Cpi-Mir-216-P1a  Cpo-Mir-216-P1a  Dme-Mir-216-P1  Dno-Mir-216-P1a  Dpu-Mir-216-P1  Dre-Mir-216-P1a  Efe-Mir-216-P1  Ete-Mir-216-P1a  Gga-Mir-216-P1a  Hsa-Mir-216-P1a  Isc-Mir-216-P1  Lgi-Mir-216-P1  Mdo-Mir-216-P1a  Mml-Mir-216-P1a  Mmu-Mir-216-P1a  Rno-Mir-216-P1a  Sha-Mir-216-P1a  Tca-Mir-216-P1  Xtr-Mir-216-P1a 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(oryCun2)
chr2: 130101540-130101601 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-216-P1a)
Mir-217-v2 chr2: 130108838-130108898 [+] UCSC Ensembl
Mir-217-v1 chr2: 130108839-130108897 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGGUUUAACCUGAAUGGCUGUGAGUUGGCUUAAUCUCAGCUGGCAACUGUGAGAUAUUCAUACAAUCCCUCACAGUGGUCUCUGGGGUUAUGCUAAACAGAGCAAUUUCCUUGCCCUUGUGG
Get precursor sequence
Structure
        10             20        30        40        50        60 
AGGUUUAACCUGAAUGG-----|   GAG     U         CU   A        AUAUUCA 
                      CUGU   UUGGC UAAUCUCAG  GGC ACUGUGAG       \
                      GACA   AAUCG AUUGGGGUC  CUG UGACACUC       U
GGUGUUCCCGUUCCUUUAACGA^   ---     U         U-   G        CCUAACA 
120       110       100           90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
He Ki Te To Wh
Mature sequence

Ocu-Mir-216-P1a_5p

MirBase accessionMIMAT0048341
Sequence
0- UAAUCUCAGCUGGCAACUGUGAG -23
Get sequence
Seed sequenceAAUCUCA
Star sequence

Ocu-Mir-216-P1a_3p*

MirBase accessionMIMAT0048342
Sequence
40- CACAGUGGUCUCUGGGGUUAUG -62
Get sequence