MirGeneDB

Gene name

Ocu-Mir-126-v1

Family name MIR-126 (all species)
Species Rabbit (Oryctolagus cuniculus)
MiRBase ID
Paralogues Ocu-Mir-126-v2  Ocu-Mir-126-v3 
Orthologues Aca-Mir-126-v1  Ami-Mir-126-v1  Bta-Mir-126-v1  Cfa-Mir-126-v1  Cin-Mir-126-v1  Cli-Mir-126-v1  Cpi-Mir-126-v1  Cpo-Mir-126-v1  Dno-Mir-126-v1  Ete-Mir-126-v1  Gga-Mir-126-v1  Hsa-Mir-126-v1  Mdo-Mir-126-v1  Mml-Mir-126-v1  Mmu-Mir-126-v1  Oan-Mir-126-v1  Rno-Mir-126-v1  Sha-Mir-126-v1  Sto-Mir-126-v1  Tgu-Mir-126-v1  Xtr-Mir-126-v1 
Node of Origin (locus) Olfactores
Node of Origin (family) Olfactores
Genome context
(oryCun2)
638401207_G757P633257FG9_corrected: 48-106 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GACCCCGGCCGCGCCUCGCUGAUGAUGAGACAUUAUUACUUUCGGUACGCGCUGUGCCACUUCAAACUCGUACCGUGAGUAAUAAUGCGCCGUCAGCAGCCCAGCACCGCAGCGCCGGG
Get precursor sequence
Structure
        10          20        30        40        50         
GACCCCGGCCGCGCCUC--|   A     AGA           U       CGCUGUGCC 
                   GCUG UGAUG   CAUUAUUACUU CGGUACG         \
                   CGAC ACUGC   GUAAUAAUGAG GCCAUGC         A
GGGCCGCGACGCCACGACC^   G     CGC           U       UCAAACUUC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentAlthough not in the assembly a contig was manually assembled based on genomic reads from the sequence read archive.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
He Ki Te To Wh
Mature sequence

Ocu-Mir-126-v1_5p

MirBase accessionNone
Sequence
0- CAUUAUUACUUUCGGUACGCG -21
Get sequence
Seed sequenceAUUAUUA
Star sequence

Ocu-Mir-126-v1_3p*

MirBase accessionNone
Sequence
38- CGUACCGUGAGUAAUAAUGCG -59
Get sequence