MirGeneDB

Gene name

Mmu-Mir-430-P7c

Family name MIR-430 (all species)
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-294
Paralogues Mmu-Mir-430-P1  Mmu-Mir-430-P2  Mmu-Mir-430-P3  Mmu-Mir-430-P4  Mmu-Mir-430-P5a  Mmu-Mir-430-P5b  Mmu-Mir-430-P5c  Mmu-Mir-430-P6  Mmu-Mir-430-P7a  Mmu-Mir-430-P7b 
Orthologues Bta-Mir-430-P7  Hsa-Mir-430-P7  Mml-Mir-430-P7  Rno-Mir-430-P7c  Xtr-Mir-430-o7 
Node of Origin (locus) Muridae
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr7: 3220655-3220712 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-430-P7c)
Mir-430-P5a chr7: 3218639-3218697 [+] UCSC Ensembl
Mir-430-P7a chr7: 3218932-3218989 [+] UCSC Ensembl
Mir-430-P5b chr7: 3219200-3219261 [+] UCSC Ensembl
Mir-430-P7b chr7: 3219494-3219550 [+] UCSC Ensembl
Mir-430-P5c chr7: 3220356-3220411 [+] UCSC Ensembl
Mir-430-P6 chr7: 3220779-3220837 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUUGGAUCUAGCGAAAUUCCAUAUAGCCAUACUCAAAAUGGAGGCCCUAUCUAAGCUUUUAAGUGGAAAGUGCUUCCCUUUUGUGUGUUGCCAUGUGGAGAAAGCAUCGGAACUUCAA
Get precursor sequence
Structure
        10          20        30        40        50        
UUUGGAUCUAGCGAAAU--|      A  C    U     U      C  A   AAGCU 
                   UCCAUAU GC AUAC CAAAA GGAGGC CU UCU     U
                   AGGUGUA CG UGUG GUUUU CCUUCG GA AGG     U
AACUUCAAGGCUACGAAAG^      C  U    U     C      U  A   UGAAU 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-430-P7c_5p*

MirBase accessionMIMAT0004574
Sequence
0- ACUCAAAAUGGAGGCCCUAUCU -22
Get sequence
Validated targets microrna.org: MIMAT0004574
TargetScanVert: mmu-miR-294-5p
miRDB: MIMAT0004574
Mature sequence

Mmu-Mir-430-P7c_3p

MirBase accessionMIMAT0000372
Sequence
36- AAAGUGCUUCCCUUUUGUGUGU -58
Get sequence
Seed sequenceAAGUGCU
Validated targets microrna.org: MIMAT0000372
TargetScanVert: mmu-miR-294-3p
miRDB: MIMAT0000372