
MirGeneDB ID


Family name MIR-430 (all species)
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-295
Paralogues Mmu-Mir-430-P1  Mmu-Mir-430-P2  Mmu-Mir-430-P3  Mmu-Mir-430-P4  Mmu-Mir-430-P5a  Mmu-Mir-430-P5b  Mmu-Mir-430-P5c  Mmu-Mir-430-P7a  Mmu-Mir-430-P7b  Mmu-Mir-430-P7c 
Orthologues Dno-Mir-430-P6  Hsa-Mir-430-P6  Mml-Mir-430-P6  Rno-Mir-430-P6a  Rno-Mir-430-P6b  Xtr-Mir-430-o6 
Node of Origin (locus) Eutheria
Node of Origin (family) Vertebrata
Genome context
chr7: 3220779-3220837 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-430-P6)
Mir-430-P5a chr7: 3218639-3218697 [+] UCSC Ensembl
Mir-430-P7a chr7: 3218932-3218989 [+] UCSC Ensembl
Mir-430-P5b chr7: 3219200-3219261 [+] UCSC Ensembl
Mir-430-P7b chr7: 3219494-3219550 [+] UCSC Ensembl
Mir-430-P5c chr7: 3220356-3220411 [+] UCSC Ensembl
Mir-430-P7c chr7: 3220655-3220712 [+] UCSC Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10            20        30        40         50         
AGAGACUCCUUGCUUGC----|   CUU  U          U    -     AC    GGACU 
                     UCAU   GG GAGACUCAAA GUGG GGCAC  UUCU     \
                     GGUG   CC CUCUGAGUUU CAUC UCGUG  AAGA     G
GUCGGCUGGACACUUACCACG^   U--  U          U    A     A-    UACAU 
       110       100          90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
Tissue expression
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence


MirBase accessionMIMAT0004575
Get sequence
Validated targets microrna.org: MIMAT0004575
TargetScanVert: mmu-miR-295-5p
miRDB: MIMAT0004575
Mature sequence


MirBase accessionMIMAT0000373
Get sequence
Validated targets microrna.org: MIMAT0000373
TargetScanVert: mmu-miR-295-3p
miRDB: MIMAT0000373