MirGeneDB

Gene name

Mmu-Mir-430-P6

Family name MIR-430 (all species)
MiRBase ID mmu-mir-295
Paralogues Mmu-Mir-430-P1  Mmu-Mir-430-P2  Mmu-Mir-430-P3  Mmu-Mir-430-P4  Mmu-Mir-430-P5a  Mmu-Mir-430-P5b  Mmu-Mir-430-P5c  Mmu-Mir-430-P7a  Mmu-Mir-430-P7b  Mmu-Mir-430-P7c 
Orthologues Dno-Mir-430-P6  Hsa-Mir-430-P6  Mml-Mir-430-P6  Rno-Mir-430-P6a  Rno-Mir-430-P6b  Xtr-Mir-430-o6 
Node of Origin (gene) Eutheria
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr7: 3220779-3220837 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-430-P6)
Mir-430-P5a chr7: 3218639-3218697 [+] UCSC Ensembl
Mir-430-P7a chr7: 3218932-3218989 [+] UCSC Ensembl
Mir-430-P5b chr7: 3219200-3219261 [+] UCSC Ensembl
Mir-430-P7b chr7: 3219494-3219550 [+] UCSC Ensembl
Mir-430-P5c chr7: 3220356-3220411 [+] UCSC Ensembl
Mir-430-P7c chr7: 3220655-3220712 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGAGACUCCUUGCUUGCUCAUCUUGGUGAGACUCAAAUGUGGGGCACACUUCUGGACUGUACAUAGAAAGUGCUACUACUUUUGAGUCUCUCCUGUGGGCACCAUUCACAGGUCGGCUG
Get precursor sequence
Structure
        10            20        30        40         50         
AGAGACUCCUUGCUUGC----|   CUU  U          U    -     AC    GGACU 
                     UCAU   GG GAGACUCAAA GUGG GGCAC  UUCU     \
                     GGUG   CC CUCUGAGUUU CAUC UCGUG  AAGA     G
GUCGGCUGGACACUUACCACG^   U--  U          U    A     A-    UACAU 
       110       100          90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-430-P6_5p*

MirBase accessionMIMAT0004575
Sequence
0- ACUCAAAUGUGGGGCACACUUCU -23
Get sequence
Validated targets microrna.org: MIMAT0004575
TargetScanVert: mmu-miR-295-5p
miRDB: MIMAT0004575
Mature sequence

Mmu-Mir-430-P6_3p

MirBase accessionMIMAT0000373
Sequence
36- AAAGUGCUACUACUUUUGAGUCU -59
Get sequence
Seed sequenceAAGUGCU
Validated targets microrna.org: MIMAT0000373
TargetScanVert: mmu-miR-295-3p
miRDB: MIMAT0000373