MirGeneDB

Gene name

Mmu-Mir-430-P5a

Family name MIR-430 (all species)
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-290a
Paralogues Mmu-Mir-430-P1  Mmu-Mir-430-P2  Mmu-Mir-430-P3  Mmu-Mir-430-P4  Mmu-Mir-430-P5b  Mmu-Mir-430-P5c  Mmu-Mir-430-P6  Mmu-Mir-430-P7a  Mmu-Mir-430-P7b  Mmu-Mir-430-P7c 
Orthologues Bta-Mir-430-P5  Cpo-Mir-430-P5  Dno-Mir-430-P5  Ete-Mir-430-P5  Hsa-Mir-430-P5  Mml-Mir-430-P5  Ocu-Mir-430-P5  Rno-Mir-430-P5a  Xtr-Mir-430-o5 
Node of Origin (locus) Muridae
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr7: 3218639-3218697 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-430-P5a)
Mir-430-P7a chr7: 3218932-3218989 [+] UCSC Ensembl
Mir-430-P5b chr7: 3219200-3219261 [+] UCSC Ensembl
Mir-430-P7b chr7: 3219494-3219550 [+] UCSC Ensembl
Mir-430-P5c chr7: 3220356-3220411 [+] UCSC Ensembl
Mir-430-P7c chr7: 3220655-3220712 [+] UCSC Ensembl
Mir-430-P6 chr7: 3220779-3220837 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUUAACGUCUGGACCGCCUCAUCUUGCGGUACUCAAACUAUGGGGGCACUUUUUUUUUUCUUUAAAAAGUGCCGCCUAGUUUUAAGCCCCGCCGGUUGAGAAAACGGCUAUCUGGCACA
Get precursor sequence
Structure
        10          20        30         40        50         
UUUAACGUCUGGACCGC--    U  U    UA  C-|     U  G          UUUU 
                   CUCA CU GCGG  CU  AAACUA GG GGCACUUUUU    \
                   GAGU GG CGCC  GA  UUUGAU CC CCGUGAAAAA    U
ACACGGUCUAUCGGCAAAA    U  C    CC  AU^     -  G          UUUC 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-430-P5a_5p

MirBase accessionMIMAT0000366
Sequence
0- ACUCAAACUAUGGGGGCACUUUUU -24
Get sequence
Seed sequenceCUCAAAC
Validated targets microrna.org: MIMAT0000366
TargetScanVert: mmu-miR-290a-5p
miRDB: MIMAT0000366
Star sequence

Mmu-Mir-430-P5a_3p*

MirBase accessionMIMAT0004572
Sequence
35- AAAGUGCCGCCUAGUUUUAAGCCC -59
Get sequence
Validated targets microrna.org: MIMAT0004572
TargetScanVert: mmu-miR-290a-3p
miRDB: MIMAT0004572