MirGeneDB

Gene name

Mmu-Mir-425

Family name MIR-425 (all species)
MiRBase ID mmu-mir-425
Paralogues
Orthologues Aca-Mir-425  Ami-Mir-425  Bta-Mir-425  Cfa-Mir-425  Cli-Mir-425  Cpi-Mir-425  Cpo-Mir-425  Dno-Mir-425  Dre-Mir-425  Ete-Mir-425  Hsa-Mir-425  Mdo-Mir-425  Mml-Mir-425  Ocu-Mir-425  Rno-Mir-425  Sha-Mir-425  Tgu-Mir-425  Xtr-Mir-425 
Node of Origin (gene) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(mm10)
chr9: 108568789-108568851 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-425)
Mir-191-v1 chr9: 108568325-108568388 [+] UCSC Ensembl
Mir-191-v2 chr9: 108568326-108568388 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACCCACACCACAGCAUGGAAAGUGCUUUGGAAUGACACGAUCACUCCCGUUGAGUGGGCACCCAAGAAGCCAUCGGGAAUGUCGUGUCCGCCCAGUGCUCUUUCGGCACCUCCCAAACAGGGC
Get precursor sequence
Structure
        10          20        30        40        50        60 
ACCCACACCACAGCAUG--|    U  U    AAU       U  C     U  AGUGGGCA 
                   GAAAG GC UUGG   GACACGA CA UCCCG UG        C
                   CUUUC CG GACC   CUGUGCU GU AGGGC AC        C
CGGGACAAACCCUCCACGG^    U  U    CGC       -  A     U  CGAAGAAC 
 120       110       100        90         80        70
Deep sequencing
Go to detailed chart
CommentThere are multiple Dicer sites +1 and +2 relative to what is annotated here. There is a minor Drosha site +1 as well.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-425_5p

MirBase accessionMIMAT0004750
Sequence
0- AAUGACACGAUCACUCCCGUUG -22
Get sequence
Seed sequenceAUGACAC
Validated targets microrna.org: MIMAT0004750
TargetScanVert: mmu-miR-425-5p
miRDB: MIMAT0004750
Star sequence

Mmu-Mir-425_3p*

MirBase accessionMIMAT0001342
Sequence
42- UCGGGAAUGUCGUGUCCGCCC -63
Get sequence
Validated targets microrna.org: MIMAT0001342
TargetScanVert: mmu-miR-425-3p
miRDB: MIMAT0001342