MirGeneDB

Gene name

Mmu-Mir-383-v2

Family name MIR-383 (all species)
MiRBase ID mmu-mir-383
Paralogues Mmu-Mir-383-v1 
Orthologues Aca-Mir-383-v2  Ami-Mir-383-v2  Bta-Mir-383-v2  Cfa-Mir-383-v2  Cli-Mir-383-v2  Cpi-Mir-383-v2  Cpo-Mir-383-v2  Dno-Mir-383-v2  Ete-Mir-383-v2  Gga-Mir-383-v2  Hsa-Mir-383-v2  Mdo-Mir-383-v2  Mml-Mir-383-v2  Ocu-Mir-383-v2  Rno-Mir-383-v2  Sha-Mir-383-v2  Tgu-Mir-383-v2  Xtr-Mir-383-v2 
Node of Origin (gene) Tetrapoda
Node of Origin (family) Tetrapoda
Genome context
(mm10)
chr8: 38252138-38252200 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-383-v2)
Mir-383-v1 chr8: 38252138-38252199 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCCUCCAGAAACUCCACGUCACCUGCUCCUCAGAUCAGAAGGUGACUGUGGCUUUGGGUGGAUAUUAAUCAGCCACAGCACUGCCUGGUCAGAAAGAGCAAGUGUCCUAGCCUUUUACCUCAU
Get precursor sequence
Structure
        10        20         30        40        50        60  
GCCUCCAGAAACUCCACGU   C     C-| A      AA    A        UUGGGUGG 
                   CAC UGCUC  UC GAUCAG  GGUG CUGUGGCU        \
                   GUG ACGAG  AG CUGGUC  UCAC GACACCGA        A
UACUCCAUUUUCCGAUCCU   A     AA^ A      CG    -        CUAAUUAU 
 120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsNo
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-383-v2_5p

MirBase accessionMIMAT0000748
Sequence
0- CAGAUCAGAAGGUGACUGUGGCU -23
Get sequence
Seed sequenceAGAUCAG
Validated targets microrna.org: MIMAT0000748
TargetScanVert: mmu-miR-383-5p.1
miRDB: MIMAT0000748
Star sequence

Mmu-Mir-383-v2_3p*

MirBase accessionMIMAT0017082
Sequence
42- CCACAGCACUGCCUGGUCAGA -63
Get sequence
Validated targets TargetScanVert: mmu-miR-383-3p
miRDB: MIMAT0017082