MirGeneDB

MirGeneDB ID

Mmu-Mir-376-P4

Family name MIR-376 (all species)
Seed ACAUAGA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-376c
Paralogues Mmu-Mir-376-P1  Mmu-Mir-376-P3 
Orthologues Bta-Mir-376-P4  Cfa-Mir-376-P4  Cpo-Mir-376-P4  Dno-Mir-376-P4  Ete-Mir-376-P4  Hsa-Mir-376-P4  Mml-Mir-376-P4  Ocu-Mir-376-P4  Rno-Mir-376-P4 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(mm10)
chr12: 109722733-109722790 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-376-P4)
Mir-154-P26 chr12: 109712823-109712880 [+] UCSC Ensembl
Mir-154-P4 chr12: 109713503-109713562 [+] UCSC Ensembl
Mir-154-P18 chr12: 109715334-109715389 [+] UCSC Ensembl
Mir-154-P29-v1 chr12: 109715715-109715771 [+] UCSC Ensembl
Mir-154-P29-v2 chr12: 109715716-109715770 [+] UCSC Ensembl
Mir-666 chr12: 109717103-109717163 [+] UCSC Ensembl
Mir-154-P22 chr12: 109717268-109717326 [+] UCSC Ensembl
Mir-154-P19 chr12: 109718757-109718816 [+] UCSC Ensembl
Mir-667 chr12: 109720020-109720083 [+] UCSC Ensembl
Mir-376-P4 chr12: 109722733-109722790 [+] UCSC Ensembl
Mir-376-P3 chr12: 109723471-109723528 [+] UCSC Ensembl
Mir-376-P1 chr12: 109723787-109723844 [+] UCSC Ensembl
Mir-154-P34 chr12: 109724322-109724384 [+] UCSC Ensembl
Mir-154-P9 chr12: 109726829-109726891 [+] UCSC Ensembl
Mir-154-P17 chr12: 109727346-109727403 [+] UCSC Ensembl
Mir-154-P21 chr12: 109728136-109728197 [+] UCSC Ensembl
Mir-544 chr12: 109729335-109729391 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUCAGGACUAAAUCUUUUGGUAUUUAAAAGGUGGAUAUUCCUUCUAUGUUUAUGCUUUUUGUGAUUAAACAUAGAGGAAAUUUCACGUUUUCAGUGUCAAAUGCUGCUGGGUAAUGGG
Get precursor sequence
Structure
        10          20        30        40        50         
UUCAGGACUAAAUCUUU--| GU   U    G     UA     U         UGCUUU 
                   UG  AUU AAAA GUGGA  UUCCU CUAUGUUUA      \
                   AC  UGA UUUU CACUU  AAGGA GAUACAAAU      U
GGGUAAUGGGUCGUCGUAA^ UG   C    G     UA     -         UAGUGU 
      110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-376-P4_5p*

MirBase accessionMIMAT0005295
Sequence
0- GUGGAUAUUCCUUCUAUGUUUA -22
Get sequence
Validated targets microrna.org: MIMAT0005295
TargetScanVert: mmu-miR-376c-5p
miRDB: MIMAT0005295
Mature sequence

Mmu-Mir-376-P4_3p

MirBase accessionMIMAT0003183
Sequence
37- AACAUAGAGGAAAUUUCACGU -58
Get sequence
Validated targets microrna.org: MIMAT0003183
TargetScanVert: mmu-miR-376c-3p
miRDB: MIMAT0003183