MirGeneDB

Gene name

Mmu-Mir-217-v2

Family name MIR-217 (all species)
MiRBase ID mmu-mir-217
Paralogues Mmu-Mir-217-v1 
Orthologues Aca-Mir-217-v2  Ami-Mir-217-v2  Bfl-Mir-217  Bta-Mir-217-v2  Cfa-Mir-217-v2  Cli-Mir-217-v2  Cpi-Mir-217-v2  Cpo-Mir-217-v2  Dno-Mir-217-v2  Ete-Mir-217-v2  Gga-Mir-217-v2  Hsa-Mir-217-v2  Mml-Mir-217-v2  Ocu-Mir-217-v2  Rno-Mir-217-v2  Tgu-Mir-217-v2  Xtr-Mir-217-v2 
Node of Origin (gene) Chordata
Node of Origin (family) Chordata
Genome context
(mm10)
chr11: 28763760-28763820 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-217-v2)
Mir-216-P1a chr11: 28757018-28757079 [+] UCSC Ensembl
Mir-217-v1 chr11: 28763761-28763819 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACAUAGUCAUUACAGUUUUUGAUGUUGCAGAUACUGCAUCAGGAACUGACUGGAUAAGACUUAAUCCCCAUCAGUUCCUAAUGCAUUGCCUUCAGCAUCUAAACAACCACCAGCAAACACC
Get precursor sequence
Structure
        10        20          30        40        50        60
ACAUAGUCAUUACAGUUUUU--|      C  A  C     C         C   AUAAGA 
                      GAUGUUG AG UA UGCAU AGGAACUGA UGG      C
                      CUACGAC UC GU ACGUA UCCUUGACU ACC      U
CCACAAACGACCACCAACAAAU^      U  C  U     A         -   CCUAAU 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-217-v2_5p

MirBase accessionMIMAT0000679
Sequence
0- AUACUGCAUCAGGAACUGACUGG -23
Get sequence
Seed sequenceUACUGCA
Validated targets microrna.org: MIMAT0000679
TargetScanVert: mmu-miR-217-5p
miRDB: MIMAT0000679
Star sequence

Mmu-Mir-217-v2_3p*

MirBase accessionMIMAT0017072
Sequence
39- AUCAGUUCCUAAUGCAUUGCCU -61
Get sequence
Validated targets TargetScanVert: mmu-miR-217-3p
miRDB: MIMAT0017072