MirGeneDB

Gene name

Mmu-Mir-214

Family name MIR-214 (all species)
MiRBase ID mmu-mir-214
Paralogues
Orthologues Aca-Mir-214  Ami-Mir-214  Bta-Mir-214  Cfa-Mir-214  Cli-Mir-214  Cpi-Mir-214  Cpo-Mir-214  Dno-Mir-214  Dre-Mir-214  Ete-Mir-214  Gga-Mir-214  Hsa-Mir-214  Mdo-Mir-214-v1  Mdo-Mir-214-v2  Mml-Mir-214  Ocu-Mir-214  Rno-Mir-214  Sha-Mir-214-v1  Sha-Mir-214-v2  Tgu-Mir-214  Xtr-Mir-214 
Node of Origin (gene) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(mm10)
chr1: 162223397-162223459 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-214)
Mir-199-P2-v1 chr1: 162217844-162217904 [+] UCSC Ensembl
Mir-199-P2-v2 chr1: 162217844-162217904 [+] UCSC Ensembl
Mir-199-P2-v3 chr1: 162217844-162217904 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCUGAAUGACCACCA
Get precursor sequence
Structure
        10          20        30        40        50        60 
GGGCCUGGCUGGACAGA--|          U          ACA          AGAACAUC 
                   GUUGUCAUGUG CUGCCUGUCU   CUUGCUGUGC        \
                   CAACAGUACAC GACGGACAGA   GGACGACAUG        C
ACCACCAGUAAGUCCGACC^          U          CAC          UCCACUCG 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-214_5p*

MirBase accessionMIMAT0004664
Sequence
0- UGCCUGUCUACACUUGCUGUGC -22
Get sequence
Validated targets microrna.org: MIMAT0004664
TargetScanVert: mmu-miR-214-5p
miRDB: MIMAT0004664
Mature sequence

Mmu-Mir-214_3p

MirBase accessionMIMAT0000661
Sequence
41- ACAGCAGGCACAGACAGGCAGU -63
Get sequence
Seed sequenceCAGCAGG
Validated targets microrna.org: MIMAT0000661
TargetScanVert: mmu-miR-214-3p
miRDB: MIMAT0000661