MirGeneDB

Gene name

Mmu-Mir-191-v1

Family name MIR-191 (all species)
MiRBase ID mmu-mir-191
Paralogues Mmu-Mir-191-v2 
Orthologues Aca-Mir-191-v1  Ami-Mir-191-v1  Bta-Mir-191-v1  Cfa-Mir-191-v1  Cpi-Mir-191-v1  Cpo-Mir-191-v1  Dno-Mir-191-v1  Dre-Mir-191  Ete-Mir-191-v1  Hsa-Mir-191-v1  Mdo-Mir-191-v1  Mml-Mir-191-v1  Ocu-Mir-191-v1  Rno-Mir-191-v1  Sha-Mir-191-v1  Xtr-Mir-191-v1 
Node of Origin (gene) Tetrapoda
Node of Origin (family) Gnathostomata
Genome context
(mm10)
chr9: 108568325-108568388 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-191-v1)
Mir-191-v2 chr9: 108568326-108568388 [+] UCSC Ensembl
Mir-425 chr9: 108568789-108568851 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGAGCCCUCCUCCAAUGGCUGGACAGCGGGCAACGGAAUCCCAAAAGCAGCUGUUGUCUCCAGAGCAUUCCAGCUGCACUUGGAUUUCGUUCCCUGCUCUCCUGCCUGAGCAGCGCCCUGGCCC
Get precursor sequence
Structure
        10          20        30        40        50        60  
AGAGCCCUCCUCCAAUG--| U   C      C          C  AA       UUGUCUCC 
                   GC GGA AGCGGG AACGGAAUCC AA  GCAGCUG        \
                   CG CCU UCGUCC UUGCUUUAGG UU  CGUCGAC        A
CCCGGUCCCGCGACGAGUC^ U   C      C          -  CA       CUUACGAG 
  120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-191-v1_5p

MirBase accessionMIMAT0000221
Sequence
0- CAACGGAAUCCCAAAAGCAGCUG -23
Get sequence
Seed sequenceAACGGAA
Validated targets microrna.org: MIMAT0000221
TargetScanVert: mmu-miR-191-5p
miRDB: MIMAT0000221
Star sequence

Mmu-Mir-191-v1_3p*

MirBase accessionMIMAT0004542
Sequence
43- CUGCACUUGGAUUUCGUUCCC -64
Get sequence
Validated targets microrna.org: MIMAT0004542
TargetScanVert: mmu-miR-191-3p
miRDB: MIMAT0004542