MirGeneDB

Gene name

Mmu-Mir-154-P18

Family name MIR-154 (all species)
MiRBase ID mmu-mir-494
Paralogues Mmu-Mir-154-P1  Mmu-Mir-154-P2-v1  Mmu-Mir-154-P2-v2  Mmu-Mir-154-P3a-v1  Mmu-Mir-154-P3a-v2  Mmu-Mir-154-P4  Mmu-Mir-154-P5  Mmu-Mir-154-P6  Mmu-Mir-154-P7  Mmu-Mir-154-P8  Mmu-Mir-154-P9  Mmu-Mir-154-P10  Mmu-Mir-154-P12  Mmu-Mir-154-P13  Mmu-Mir-154-P14  Mmu-Mir-154-P15  Mmu-Mir-154-P17  Mmu-Mir-154-P19  Mmu-Mir-154-P20-v1  Mmu-Mir-154-P20-v2  Mmu-Mir-154-P21  Mmu-Mir-154-P22  Mmu-Mir-154-P26  Mmu-Mir-154-P29-v1  Mmu-Mir-154-P29-v2  Mmu-Mir-154-P30  Mmu-Mir-154-P34  Mmu-Mir-154-P36 
Orthologues Bta-Mir-154-P18  Cfa-Mir-154-P18  Cpo-Mir-154-P18  Dno-Mir-154-P18  Ete-Mir-154-P18  Hsa-Mir-154-P18  Mml-Mir-154-P18  Rno-Mir-154-P18 
Node of Origin (gene) Eutheria
Node of Origin (family) Eutheria
Genome context
(mm10)
chr12: 109715334-109715389 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-154-P18)
Mir-154-P7 chr12: 109709065-109709122 [+] UCSC Ensembl
Mir-154-P13 chr12: 109710190-109710245 [+] UCSC Ensembl
Mir-154-P2-v1 chr12: 109710643-109710697 [+] UCSC Ensembl
Mir-154-P2-v2 chr12: 109710644-109710696 [+] UCSC Ensembl
Mir-154-P8 chr12: 109711806-109711862 [+] UCSC Ensembl
Mir-154-P30 chr12: 109712361-109712416 [+] UCSC Ensembl
Mir-154-P3a-v2 chr12: 109712523-109712578 [+] UCSC Ensembl
Mir-154-P3a-v1 chr12: 109712523-109712578 [+] UCSC Ensembl
Mir-154-P26 chr12: 109712823-109712880 [+] UCSC Ensembl
Mir-154-P4 chr12: 109713503-109713562 [+] UCSC Ensembl
Mir-154-P29-v1 chr12: 109715715-109715771 [+] UCSC Ensembl
Mir-154-P29-v2 chr12: 109715716-109715770 [+] UCSC Ensembl
Mir-666 chr12: 109717103-109717163 [+] UCSC Ensembl
Mir-154-P22 chr12: 109717268-109717326 [+] UCSC Ensembl
Mir-154-P19 chr12: 109718757-109718816 [+] UCSC Ensembl
Mir-667 chr12: 109720020-109720083 [+] UCSC Ensembl
Mir-376-P4 chr12: 109722733-109722790 [+] UCSC Ensembl
Mir-376-P3 chr12: 109723471-109723528 [+] UCSC Ensembl
Mir-376-P1 chr12: 109723787-109723844 [+] UCSC Ensembl
Mir-154-P34 chr12: 109724322-109724384 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUGACCAGUGCUAAUUGAUACUUGAAGGAGAGGUUGUCCGUGUUGUCUUCUCUUUAUUUAUGAUGAAACAUACACGGGAAACCUCUUUUUUAGUAUCAAAUCCCACCCUGGGGGCA
Get precursor sequence
Structure
        10           20        30        40         50        
CUGACCAGUGCUAAUUG---|    U            GU      -   C   -  UUUA 
                    AUACU GAAGGAGAGGUU  CCGUGU UGU UUC UC    \
                    UAUGA UUUUUUCUCCAA  GGCACA ACA AAG AG    U
ACGGGGGUCCCACCCUAAAC^    -            AG      U   -   U  UAUU 
    110       100         90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-154-P18_5p*

MirBase accessionMIMAT0017215
Sequence
0- AGGUUGUCCGUGUUGUCUUCUCU -23
Get sequence
Validated targets TargetScanVert: mmu-miR-494-5p
miRDB: MIMAT0017215
Mature sequence

Mmu-Mir-154-P18_3p

MirBase accessionMIMAT0003182
Sequence
33- UGAAACAUACACGGGAAACCUCU -56
Get sequence
Seed sequenceGAAACAU
Validated targets microrna.org: MIMAT0003182
TargetScanVert: mmu-miR-494-3p
miRDB: MIMAT0003182