MirGeneDB

MirGeneDB ID

Mmu-Mir-150

Family name MIR-150 (all species)
Seed CUCCCAA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-150
Paralogues
Orthologues Aca-Mir-150  Ami-Mir-150  Bta-Mir-150  Cfa-Mir-150  Cpo-Mir-150  Dno-Mir-150  Dre-Mir-150  Ete-Mir-150  Hsa-Mir-150  Mdo-Mir-150  Mml-Mir-150  Oan-Mir-150  Ocu-Mir-150  Rno-Mir-150  Sha-Mir-150  Sto-Mir-150  Xtr-Mir-150 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(mm10)
chr7: 45121762-45121818 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGCAGGCAGAGGACUCUUCUCAAUGCCCUGUCUCCCAACCCUUGUACCAGUGCUGUGCCUCAGACCCUGGUACAGGCCUGGGGGAUAGGGACUUGGGAACCCCAGCAGCAACAACUC
Get precursor sequence
Structure
        10          20        30        40        50        
UGCAGGCAGAGGACUCU--|     UG            AC   U       UGCUGUG 
                   UCUCAA  CCCUGUCUCCCA  CCU GUACCAG       C
                   AGGGUU  GGGAUAGGGGGU  GGA CAUGGUC       C
CUCAACAACGACGACCCCA^     CA            CC   -       CCAGACU 
     110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-150_5p

MirBase accessionMIMAT0000160
Sequence
0- UCUCCCAACCCUUGUACCAGUG -22
Get sequence
Validated targets microrna.org: MIMAT0000160
TargetScanVert: mmu-miR-150-5p
miRDB: MIMAT0000160
Star sequence

Mmu-Mir-150_3p*

MirBase accessionMIMAT0004535
Sequence
36- CUGGUACAGGCCUGGGGGAUA -57
Get sequence
Validated targets microrna.org: MIMAT0004535
TargetScanVert: mmu-miR-150-3p
miRDB: MIMAT0004535