MirGeneDB

MirGeneDB ID

Mmu-Mir-149

Family name MIR-149 (all species)
Seed CUGGCUC
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-149
Paralogues
Orthologues Bta-Mir-149  Cfa-Mir-149  Cpo-Mir-149  Dno-Mir-149  Ete-Mir-149  Hsa-Mir-149  Mml-Mir-149  Ocu-Mir-149  Rno-Mir-149 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(mm10)
chr1: 92850381-92850442 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGCCCGGGGCCCUCAGGCCAGUGCCCAGGCUCUGGCUCCGUGUCUUCACUCCCGUGUUUGUCCGAGGAGGGAGGGAGGGACGGGGGCGGUGCUGGGGCAACUGGAACAGCGCAGGUCACCGG
Get precursor sequence
Structure
        10         20         30        40        50        60 
UGCCCGGGGCCCUCAGG-    -|    A   U   G      G     A     GUGUUUG 
                  CCAG UGCCC GGC CUG CUCCGU UCUUC CUCCC       \
                  GGUC ACGGG UCG GGC GGGGCA GGAGG GAGGG       U
GGCCACUGGACGCGACAA    A^    G   U   G      G     -     AGGAGCC 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-149_5p

MirBase accessionMIMAT0000159
Sequence
0- UCUGGCUCCGUGUCUUCACUCCC -23
Get sequence
Validated targets microrna.org: MIMAT0000159
TargetScanVert: mmu-miR-149-5p
miRDB: MIMAT0000159
Star sequence

Mmu-Mir-149_3p*

MirBase accessionMIMAT0016990
Sequence
40- GAGGGAGGGACGGGGGCGGUGC -62
Get sequence
Validated targets TargetScanVert: mmu-miR-149-3p
miRDB: MIMAT0016990