MirGeneDB

Gene name

Mmu-Mir-130-P1b

Family name MIR-130 (all species)
MiRBase ID mmu-mir-130b
Paralogues Mmu-Mir-130-P1a  Mmu-Mir-130-P2a  Mmu-Mir-130-P2b 
Orthologues Aca-Mir-130-P1b  Bta-Mir-130-P1b  Cfa-Mir-130-P1b  Cpi-Mir-130-P1b  Cpo-Mir-130-P1b  Dno-Mir-130-P1b  Dre-Mir-130-P1b1  Ete-Mir-130-P1b  Gga-Mir-130-P1b  Hsa-Mir-130-P1b  Mdo-Mir-130-P1b  Mml-Mir-130-P1b  Ocu-Mir-130-P1b  Rno-Mir-130-P1b  Sha-Mir-130-P1b  Tgu-Mir-130-P1b  Xtr-Mir-130-P1b 
Node of Origin (gene) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr16: 17124071-17124130 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-130-P1b)
Mir-130-P2b chr16: 17124420-17124477 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CACCCCGUGAGACUGACAGGCUUGUUGGACACUCUUUCCCUGUUGCACUACUGUGGGCCUCUGGGAAGCAGUGCAAUGAUGAAAGGGCAUCUGUCGGGCCAGCUAAGGAGCCUGAGGAAC
Get precursor sequence
Structure
        10          20        30        40        50         
CACCCCGUGAGACUGACA--|     U    CA       CC         A  GUGGGC 
                    GGCUUG UGGA  CUCUUUC  UGUUGCACU CU      C
                    CCGGGC GUCU  GGGAAAG  GUAACGUGA GA      U
CAAGGAGUCCGAGGAAUCGA^     U    AC       UA         C  AGGGUC 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsUGUG in loop
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-130-P1b_5p*

MirBase accessionMIMAT0004583
Sequence
0- ACUCUUUCCCUGUUGCACUACU -22
Get sequence
Validated targets microrna.org: MIMAT0004583
TargetScanVert: mmu-miR-130b-5p
miRDB: MIMAT0004583
Mature sequence

Mmu-Mir-130-P1b_3p

MirBase accessionMIMAT0000387
Sequence
38- CAGUGCAAUGAUGAAAGGGCAU -60
Get sequence
Seed sequenceAGUGCAA
Validated targets microrna.org: MIMAT0000387
TargetScanVert: mmu-miR-130b-3p
miRDB: MIMAT0000387