MirGeneDB

Gene name

Mmu-Let-7-P7

Family name LET-7 (all species)
MiRBase ID mmu-let-7c-2
Paralogues Mmu-Let-7-P1  Mmu-Let-7-P2  Mmu-Let-7-P3  Mmu-Let-7-P4  Mmu-Let-7-P5  Mmu-Let-7-P6  Mmu-Let-7-P8  Mmu-Let-7-P9  Mmu-Let-7-P10  Mmu-Let-7-P11  Mmu-Let-7-P12 
Orthologues Aae-Let-7  Aca-Let-7-P7  Ami-Let-7-P7  Bge-Let-7  Bta-Let-7-P7  Cfa-Let-7-P7  Cgi-Let-7  Cli-Let-7-P7  Cpi-Let-7-P7  Cpo-Let-7-P7  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dno-Let-7-P7  Dpu-Let-7  Dre-Let-7-P7  Ete-Let-7-P7  Gga-Let-7-P7  Hme-Let-7  Hsa-Let-7-P7  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mdo-Let-7-P7  Mml-Let-7-P7  Ocu-Let-7-P7  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P7  Sha-Let-7-P7  Sko-Let-7  Spu-Let-7  Tca-Let-7  Tgu-Let-7-P7  Xtr-Let-7-P7 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(mm10)
chr15: 85706616-85706684 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Let-7-P7)
Let-7-P8 chr15: 85707325-85707399 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UACGCCAAGACUGACUGACGGCCUUUGGGGUGAGGUAGUAGGUUGUAUGGUUUUGGGCUCUGCCCCGCUCUGCGGUAACUAUACAAUCUACUGUCUUUCCUGAAGUGGCCGCAAUAUCUGCAGUGGAUA
Get precursor sequence
Structure
        10        20         30        40        50        60    
UACGCCAAGACUGACUGA     -|  G   U   GU                UUGGGCUCUGC 
                  CGGCC UUU GGG GAG  AGUAGGUUGUAUGGUU           C
                  GCCGG GAA UCC UUC  UCAUCUAACAUAUCAA           C
AUAGGUGACGUCUAUAAC     U^  G   U   UG                UGGCGUCUCGC 
       120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsNo
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Let-7-P7_5p

MirBase accessionMIMAT0000523
Sequence
0- UGAGGUAGUAGGUUGUAUGGUU -22
Get sequence
Seed sequenceGAGGUAG
Validated targets microrna.org: MIMAT0000523
TargetScanVert: mmu-let-7c-5p
miRDB: MIMAT0000523
Star sequence

Mmu-Let-7-P7_3p*

MirBase accessionMIMAT0005439
Sequence
48- CUAUACAAUCUACUGUCUUUC -69
Get sequence
Validated targets microrna.org: MIMAT0005439
TargetScanVert: mmu-let-7c-2-3p
miRDB: MIMAT0005439