MirGeneDB

Gene name

Mml-Mir-126-v1

Family name MIR-126 (all species)
Species Rhesus monkey (Macaca mulatta)
MiRBase ID mml-mir-126
Paralogues Mml-Mir-126-v2  Mml-Mir-126-v3 
Orthologues Aca-Mir-126-v1  Ami-Mir-126-v1  Bta-Mir-126-v1  Cfa-Mir-126-v1  Cin-Mir-126-v1  Cli-Mir-126-v1  Cpi-Mir-126-v1  Cpo-Mir-126-v1  Dno-Mir-126-v1  Ete-Mir-126-v1  Gga-Mir-126-v1  Hsa-Mir-126-v1  Mdo-Mir-126-v1  Mmu-Mir-126-v1  Oan-Mir-126-v1  Ocu-Mir-126-v1  Rno-Mir-126-v1  Sha-Mir-126-v1  Sto-Mir-126-v1  Tgu-Mir-126-v1  Xtr-Mir-126-v1 
Node of Origin (locus) Olfactores
Node of Origin (family) Olfactores
Genome context
(rheMac8)
chr15: 1641807-1641865 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-126-v1)
Mir-126-v2 chr15: 1641807-1641865 [-] UCSC Ensembl
Mir-126-v3 chr15: 1641807-1641865 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAAGACGCCACGCCCCCGCUGGUGAUGGGACAUUAUUACUUUUGGUACGCGCUGUGACACUUCAAACUCGUACCGUGAGUAAUAAUGCGCUGUCCACAGCACCGCAUCGAAAGCGCCGC
Get precursor sequence
Structure
        10          20        30        40        50         
GAAGACGCCACGCCCCC--|   GU     GA           U       CGCUGUGAC 
                   GCUG  GAUGG  CAUUAUUACUU UGGUACG         \
                   CGAC  CUGUC  GUAAUAAUGAG GCCAUGC         A
CGCCGCGAAAGCUACGCCA^   AC     GC           U       UCAAACUUC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Br Br Br He Ki Li Lu Ly Sk Sp Te Th
Mature sequence

Mml-Mir-126-v1_5p

MirBase accessionNone
Sequence
0- CAUUAUUACUUUUGGUACGCG -21
Get sequence
Seed sequenceAUUAUUA
Star sequence

Mml-Mir-126-v1_3p*

MirBase accessionMIMAT0006183
Sequence
38- CGUACCGUGAGUAAUAAUGCG -59
Get sequence
Validated targets TargetScanVert: mml-miR-126