MirGeneDB

Gene name

Lgi-Mir-9

Family name MIR-9 (all species)
MiRBase ID lgi-mir-9
Paralogues
Orthologues Aae-Mir-9-P7a  Aae-Mir-9-P7b  Aae-Mir-9-P8  Aae-Mir-9-P9  Aae-Mir-9-P10-v1  Aae-Mir-9-P10-v2  Aca-Mir-9-P2  Aca-Mir-9-P3  Aca-Mir-9-P4  Ami-Mir-9-P1  Ami-Mir-9-P2  Ami-Mir-9-P3  Ami-Mir-9-P4  Asu-Mir-9-o13  Asu-Mir-9-o14-v1  Asu-Mir-9-o14-v2  Bfl-Mir-9-P5  Bfl-Mir-9-P6  Bge-Mir-9-o17  Bge-Mir-9-o18-v1  Bge-Mir-9-o18-v2  Bge-Mir-9-o19  Bge-Mir-9-o20  Bta-Mir-9-P1  Bta-Mir-9-P2  Bta-Mir-9-P3  Cbr-Mir-9-o10  Cbr-Mir-9-o11  Cbr-Mir-9-o12  Cel-Mir-9-o10  Cel-Mir-9-o11  Cel-Mir-9-o12  Cfa-Mir-9-P1  Cfa-Mir-9-P2  Cfa-Mir-9-P3  Cgi-Mir-9-P12  Cgi-Mir-9-P13  Cgi-Mir-9-P14  Cin-Mir-9  Cli-Mir-9-P1  Cli-Mir-9-P2  Cli-Mir-9-P4  Cpi-Mir-9-P1  Cpi-Mir-9-P2  Cpi-Mir-9-P3  Cpi-Mir-9-P4  Cpo-Mir-9-P1  Cpo-Mir-9-P2  Cpo-Mir-9-P3  Cte-Mir-9  Dan-Mir-9-P7  Dan-Mir-9-P8  Dan-Mir-9-P9  Dan-Mir-9-P10-v1  Dan-Mir-9-P10-v2  Dan-Mir-9-P11  Dme-Mir-9-P7  Dme-Mir-9-P8  Dme-Mir-9-P9  Dme-Mir-9-P10-v1  Dme-Mir-9-P10-v2  Dme-Mir-9-P11  Dmo-Mir-9-P7  Dmo-Mir-9-P8  Dmo-Mir-9-P9  Dmo-Mir-9-P10-v1  Dmo-Mir-9-P10-v2  Dmo-Mir-9-P11  Dno-Mir-9-P1  Dno-Mir-9-P2  Dno-Mir-9-P3  Dpu-Mir-9-o8  Dpu-Mir-9-o9  Dre-Mir-9-o1  Dre-Mir-9-o2  Dre-Mir-9-P1  Dre-Mir-9-P2a  Dre-Mir-9-P2b  Dre-Mir-9-P3  Dre-Mir-9-P4  Efe-Mir-9-P15  Efe-Mir-9-P16  Ete-Mir-9-P1  Ete-Mir-9-P2  Ete-Mir-9-P3  Gga-Mir-9-P1  Gga-Mir-9-P2  Gga-Mir-9-P3  Gga-Mir-9-P4  Hme-Mir-9-o14  Hme-Mir-9-o15  Hme-Mir-9-o16  Hme-Mir-9-o17  Hsa-Mir-9-P1  Hsa-Mir-9-P2  Hsa-Mir-9-P3  Isc-Mir-9  Lan-Mir-9  Mdo-Mir-9-P1  Mdo-Mir-9-P2  Mdo-Mir-9-P3  Mdo-Mir-9-P4  Mml-Mir-9-P1  Mml-Mir-9-P2  Mml-Mir-9-P3  Mmu-Mir-9-P1  Mmu-Mir-9-P2  Mmu-Mir-9-P3  Ocu-Mir-9-P1  Ocu-Mir-9-P2  Ocu-Mir-9-P3  Pfl-Mir-9-v1  Pfl-Mir-9-v2  Pmi-Mir-9  Rno-Mir-9-P1  Rno-Mir-9-P2  Rno-Mir-9-P3  Sha-Mir-9-P1  Sha-Mir-9-P2  Sha-Mir-9-P3  Sha-Mir-9-P4  Sko-Mir-9-v1  Sko-Mir-9-v2  Spu-Mir-9  Tca-Mir-9-o3  Tca-Mir-9-o4  Tca-Mir-9-o5  Tca-Mir-9-o6-v1  Tca-Mir-9-o6-v2  Tca-Mir-9-o7-v1  Tca-Mir-9-o7-v2  Tgu-Mir-9-P2  Tgu-Mir-9-P3  Xtr-Mir-9-P1  Xtr-Mir-9-P2  Xtr-Mir-9-P3  Xtr-Mir-9-P4 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
sca_14: 1751428-1751489 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GAAAGGGGUGAAGUGAAAGCUCUGUUUUUGUCUUUGGUUAUCUAGCUGUAUGAUUGAAAUAGAAACAUUAUAAAGCUAGGUUACCAAAGGCAAAAAUGGUGACUAUACUCUACUACUGGUGU
Get precursor sequence
Structure
        10         20         30        40        50        60
GAAAGGGGUGAAGUGAA-  CU-|                U        G    AUUGAAA 
                  AG   CUGUUUUUGUCUUUGGU AUCUAGCU UAUG       U
                  UC   GGUAAAAACGGAAACCA UGGAUCGA AUAU       A
UGUGGUCAUCAUCUCAUA  AGU^                U        A    UACAAAG 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site +1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Lgi-Mir-9_5p

MirBase accessionMIMAT0009562
Sequence
0- UCUUUGGUUAUCUAGCUGUAUG -22
Get sequence
Seed sequenceCUUUGGU
Star sequence

Lgi-Mir-9_3p*

MirBase accessionMIMAT0009572
Sequence
40- UAAAGCUAGGUUACCAAAGGCA -62
Get sequence