MirGeneDB

Gene name

Lan-Mir-92-o68b

Family name MIR-92 (all species)
MiRBase ID
Paralogues Lan-Mir-92-o67a  Lan-Mir-92-o67b  Lan-Mir-92-o68a  Lan-Mir-92-o69 
Orthologues Asu-Mir-92  Cbr-Mir-92-o68  Cel-Mir-92  Isc-Mir-92 
Node of Origin (gene) L. anatina
Node of Origin (family) Bilateria
Genome context
(LinAna_1.0)
LFEI01000276: 122217-122275 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AAGAAAUGACGGAAUAACUCUAGGGCACGUAGGCAGUGAUGAGGGCAAUAUUGUGAAAGAAAUGGCAAAUUGCACUCGUCCCGGCCUGCUGGACCCUUAACAUACGGCACUCCUUGUGG
Get precursor sequence
Structure
        10        20          30        40        50         
AAGAAAUGACGGAAUAACUCU-    CA -|     AGU      G     A   UGAAA 
                      AGGG  C GUAGGC   GAUGAG GCAAU UUG     G
                      UCCC  G CGUCCG   CUGCUC CGUUA AAC     A
GGUGUUCCUCACGGCAUACAAU    AG U^     GCC      A     -   GGUAA 
       110       100        90        80        70         60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To To
Star sequence

Lan-Mir-92-o68b_5p*

MirBase accessionNone
Sequence
0- AGGCAGUGAUGAGGGCAAUAUUG -23
Get sequence
Mature sequence

Lan-Mir-92-o68b_3p

MirBase accessionNone
Sequence
37- AAUUGCACUCGUCCCGGCCUGC -59
Get sequence
Seed sequenceAUUGCAC