MirGeneDB

Gene name

Lan-Mir-92-o67a

Family name MIR-92 (all species)
MiRBase ID
Paralogues Lan-Mir-92-o67b  Lan-Mir-92-o68a  Lan-Mir-92-o68b  Lan-Mir-92-o69 
Orthologues Asu-Mir-92  Cbr-Mir-92-o67  Cel-Mir-92  Isc-Mir-92 
Node of Origin (gene) L. anatina
Node of Origin (family) Bilateria
Genome context
(LinAna_1.0)
LFEI01000276: 124834-124893 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AUUUAAGUAAAAGAGUGUGUUGUACGUGACAGGCGGAACGAGAGCAACUUUGAUAACUUUUGUCCCCAAAUUGCACUCGUCCCGGCCUGCCGCGCUCGGCAUUCCGACGUCUAGCUGCAC
Get precursor sequence
Structure
        10          20        30         40        50         
AUUUAAGUAAAAGAGUG--     UA    A    -|  A     A    C    AUAACU 
                   UGUUG  CGUG CAGG CGG ACGAG GCAA UUUG      U
                   ACGGC  GCGC GUCC GCC UGCUC CGUU AAAC      U
CACGUCGAUCUGCAGCCUU     UC    C    G^  C     A    -    CCCUGU 
.       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To To
Star sequence

Lan-Mir-92-o67a_5p* (predicted)

MirBase accessionNone
Sequence
0- AGGCGGAACGAGAGCAACUUUG -22
Get sequence
Mature sequence

Lan-Mir-92-o67a_3p

MirBase accessionNone
Sequence
38- AAUUGCACUCGUCCCGGCCUGC -60
Get sequence
Seed sequenceAUUGCAC